ID: 1125743685

View in Genome Browser
Species Human (GRCh38)
Location 15:41984840-41984862
Sequence ATGGACAAAAGCCCTTTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125743680_1125743685 5 Left 1125743680 15:41984812-41984834 CCAGTTGCAAGCTGCTTCCCCAA 0: 1
1: 0
2: 1
3: 14
4: 160
Right 1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 105
1125743678_1125743685 29 Left 1125743678 15:41984788-41984810 CCGAGGCAGTAGGTGGATGCACC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 105
1125743679_1125743685 8 Left 1125743679 15:41984809-41984831 CCTCCAGTTGCAAGCTGCTTCCC 0: 1
1: 0
2: 1
3: 16
4: 176
Right 1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 105
1125743677_1125743685 30 Left 1125743677 15:41984787-41984809 CCCGAGGCAGTAGGTGGATGCAC 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125743685 Original CRISPR ATGGACAAAAGCCCTTTCGT TGG Intronic
902738558 1:18418046-18418068 ATGGACAAAGGCCCTGTGGCTGG - Intergenic
904013248 1:27402309-27402331 AAGGACAAAAAGCCTTTCATGGG - Intergenic
904316871 1:29671409-29671431 ATGCACAAAAGGCTTTTCCTGGG - Intergenic
906273474 1:44499372-44499394 CTGGACAAAAGCCATTTCACAGG - Intronic
916121380 1:161531177-161531199 AAAGACAAAAACCCTTGCGTTGG - Intergenic
916497872 1:165361449-165361471 ATGAACAAATGCCCTTTACTTGG + Intergenic
919139628 1:193554667-193554689 TTGGACAAAAGCACTTTTATGGG + Intergenic
919989506 1:202699380-202699402 ATGGACAAATGCCCTGCCGCAGG - Intronic
1063437772 10:6048453-6048475 ATGGCCAAAGGCCCTTCCCTCGG - Intronic
1064894574 10:20220308-20220330 ATGGACATAAGCCCTATGTTGGG + Intronic
1068021187 10:51586598-51586620 ATGGACAAAACCACTTTGTTGGG - Intronic
1077699051 11:4423072-4423094 ATTGACAAAAGCCATTTCAGTGG - Intergenic
1079351392 11:19694851-19694873 TTGGAAAAAAGGCCTTTCTTGGG + Intronic
1080869010 11:36220759-36220781 AAGCACAAAATACCTTTCGTGGG + Intronic
1084493418 11:69490231-69490253 TCGGACAAAAGCCCATTCGGCGG - Intergenic
1085888193 11:80545701-80545723 ATTGGCAAAAGCACTTTAGTAGG - Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1105636493 13:22220554-22220576 ATGGACAAAATCCATCTCTTGGG - Intergenic
1106122634 13:26873292-26873314 ATGGAAAAGAGCCCTACCGTGGG + Intergenic
1109912595 13:68934570-68934592 ATTGATAATAGCCCTTTCCTGGG - Intergenic
1110800849 13:79692927-79692949 ATTGTGAAAAGCCCTTTCCTTGG + Intergenic
1114046335 14:18879807-18879829 ATGGACAAAGGCACTCTCCTAGG + Intergenic
1114117877 14:19639643-19639665 ATGGACAAAGGCACTCTCCTAGG - Intergenic
1115459258 14:33641412-33641434 ATCTACAAAAGCCCTTTAGCTGG - Intronic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1117778343 14:59205633-59205655 AAGGACAAAAGACCTGTCTTTGG - Intronic
1118858263 14:69640925-69640947 AAGGATAAAAACCCTTTCTTAGG - Intronic
1119895219 14:78214231-78214253 ATGGACAAAGGCCCTGTGGTAGG - Intergenic
1119981965 14:79091727-79091749 ATGGGCAGAAGCCCTGTCTTGGG - Intronic
1121911323 14:97794965-97794987 ATGGCCACAAGCCCTTTCAGAGG - Intergenic
1124944724 15:34253914-34253936 ATGGATAAAAGCCCTGACCTAGG + Intronic
1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG + Intronic
1128194973 15:65744755-65744777 ATGTACAGAAGCCTTTTTGTTGG + Intronic
1129556532 15:76516074-76516096 ATTGACAAAGGCCCTGTGGTTGG - Intronic
1130868517 15:87952368-87952390 AAGGGCAAGAGCCCTTTCATGGG - Intronic
1136564201 16:31060491-31060513 ATGAACAATACCCCTTTTGTGGG + Intergenic
1140936831 16:79679193-79679215 ATGGACCAAAGCCATTTATTGGG - Intergenic
1142556899 17:784827-784849 ATGGCCAAAAGCCATTCAGTAGG - Intronic
1148013189 17:44502537-44502559 ATGGAAAAATGCCCTTACGATGG - Intronic
1157197995 18:45635549-45635571 ATGGACAAGAGCCATTTCCATGG + Intronic
1159994209 18:74947182-74947204 AAGGACAAAAGCAATTTTGTGGG + Intronic
1166886375 19:45963471-45963493 ATGCACAAAAGCCCTAAGGTGGG - Intronic
927233017 2:20843810-20843832 GTGGACACAAGCCCTTGCCTTGG - Intergenic
928825150 2:35411712-35411734 ATGGTCAAGAGCTCTTTTGTAGG - Intergenic
935640319 2:105283972-105283994 ATGAACCAAAGCACTTTCCTAGG + Intronic
938161440 2:128988058-128988080 ATGTGCAAAAGCCCTTTGGCAGG + Intergenic
940383473 2:153043506-153043528 AAGTACAAAAGCCCTGTGGTAGG + Intergenic
941677143 2:168355912-168355934 AGGAACAAAAGCCATTTTGTAGG - Intergenic
942659037 2:178244770-178244792 ATGGAAAAAAGCACTTACCTAGG + Intronic
942705840 2:178771005-178771027 ATGCAAAAAAGCCATTTCTTAGG - Intronic
942977362 2:182034426-182034448 ATGTACAAAAGCCCTGAGGTGGG + Intronic
948194244 2:236083212-236083234 ACTGACAACAGCCCTTTCTTTGG - Intronic
948539932 2:238683808-238683830 ATGCACAAACCCCCTTTCTTAGG + Intergenic
1172015913 20:31872761-31872783 ATGGGCAAAAGCCCTATGATGGG + Intronic
1173557066 20:43973807-43973829 ATGCACACATGCCCTTGCGTAGG + Intronic
1178365459 21:31985985-31986007 ATGGAGACAAGCCCTTTGGAAGG + Intronic
1178606186 21:34037953-34037975 ATGGACACAAGCCCTTGGGGAGG - Intergenic
1180464871 22:15602443-15602465 ATGGACAAAGGCACTCTCCTAGG + Intergenic
1181914525 22:26268914-26268936 CTGGGCAAAAGCCCTCACGTTGG - Intronic
949438173 3:4051377-4051399 CTGGACAAAACCACTTTCTTGGG - Intronic
949641460 3:6039889-6039911 AAGGACAAGAGCCATTTCTTTGG - Intergenic
955206597 3:56901230-56901252 ATGAATAAAGGCCCTTTCATTGG + Intronic
960845735 3:122002999-122003021 ATTCACTAAAGCCCTTTTGTGGG + Intronic
961156800 3:124686527-124686549 ATGAACAAAAGCCCTGAGGTGGG + Intronic
961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG + Intergenic
961967206 3:130918228-130918250 ATGAACAAGAGCCCTCTCCTTGG + Intronic
965785841 3:172333718-172333740 ATGGCCAAATGCCCTTGCCTGGG + Intronic
966227517 3:177613886-177613908 ATTGACTAAACCCCTTTCATTGG - Intergenic
966316751 3:178655993-178656015 AAGGAGAAAAGGCCTTTTGTGGG - Intronic
969211838 4:5693698-5693720 ATGGCCAAGAGCCCTTTTTTGGG - Intronic
969263961 4:6052344-6052366 ATGAACAAAAGTCATTTTGTAGG + Intronic
970546633 4:17136819-17136841 ATGGACACATGCCCTTTGCTTGG - Intergenic
971824983 4:31609621-31609643 GTGGTCAAAAGCTCTTTCATTGG + Intergenic
972809744 4:42570267-42570289 AGGCACAAAAGCCCTTTGGTAGG - Intronic
980527032 4:134003430-134003452 ATAGACAAAAGCCCTGCCTTTGG - Intergenic
986106033 5:4660509-4660531 ATGTACATAGGCCCTTTCCTTGG - Intergenic
986403870 5:7406292-7406314 ATGGAGAAAAGACCATTCATTGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
993254408 5:85570390-85570412 CTGGACAAAAGTCCTTTGATGGG + Intergenic
995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG + Intergenic
996606500 5:125329268-125329290 ATAGGCAAAAGCCCTTAGGTAGG - Intergenic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998338172 5:141392928-141392950 ACGGACAAAGGCTCCTTCGTGGG + Exonic
1001400761 5:171445163-171445185 ATGTGCAAAAGCCCTGTGGTGGG + Intronic
1005007944 6:21309074-21309096 ATGTACAAAAGCCCCTCCATGGG + Intergenic
1005616310 6:27576571-27576593 ATGCACAAAAGCCCATTTCTGGG - Intergenic
1005983574 6:30856082-30856104 GTGGACAAATGCCCTTCCTTAGG + Intergenic
1008442851 6:51552938-51552960 AAGGACAAATTCCCTTTCGCAGG - Intergenic
1012210521 6:96512747-96512769 ATAAACAAAAGCCCTTTGGGAGG + Intergenic
1012500827 6:99886617-99886639 TTGGACATAAGCCCTTGCCTAGG + Intergenic
1018013301 6:159691812-159691834 AAGGAAAATAGCCCTTTAGTGGG - Intronic
1020585564 7:10061328-10061350 ATGTGCAAAAGCCCTATTGTAGG - Intergenic
1022498429 7:30867661-30867683 AGAGATAACAGCCCTTTCGTGGG - Intronic
1023975781 7:45028746-45028768 ATGGAAAAAGGACCTTTCCTCGG - Intronic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1037638905 8:20724881-20724903 ATGGACAAAGGCCCTGAGGTAGG + Intergenic
1041851368 8:62396926-62396948 AAGGACAAAAGCCCTTGAGCGGG + Intronic
1047996720 8:130343512-130343534 GTGGAGAAAAGCACTTTCCTAGG + Intronic
1053377221 9:37617858-37617880 CTGGACAGCTGCCCTTTCGTGGG + Intronic
1062650689 9:137575387-137575409 CTGTACCAAAGCCCTTTCCTGGG + Intronic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1190691919 X:52919632-52919654 AGGGACAAAAGCCCTATTGAAGG + Intergenic
1190694064 X:52936160-52936182 AGGGACAAAAGCCCTATTGAAGG - Intronic
1190827153 X:54028176-54028198 AAGTACAAAAGCCCTGTGGTGGG + Intronic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1197549988 X:127878921-127878943 ATGGACAAAACCCCTAACATTGG + Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic