ID: 1125743699

View in Genome Browser
Species Human (GRCh38)
Location 15:41984905-41984927
Sequence CTGGTTCCAGTCGCCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125743699_1125743704 12 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743704 15:41984940-41984962 CAGAGCTGCCCAGGCCCCTGTGG 0: 1
1: 8
2: 10
3: 89
4: 539
1125743699_1125743709 24 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743709 15:41984952-41984974 GGCCCCTGTGGGATGTGCATGGG 0: 1
1: 0
2: 0
3: 19
4: 163
1125743699_1125743705 13 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743705 15:41984941-41984963 AGAGCTGCCCAGGCCCCTGTGGG 0: 1
1: 0
2: 2
3: 40
4: 308
1125743699_1125743702 3 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743702 15:41984931-41984953 ATACACAGCCAGAGCTGCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 223
1125743699_1125743713 30 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743713 15:41984958-41984980 TGTGGGATGTGCATGGGCTTTGG 0: 1
1: 0
2: 3
3: 32
4: 328
1125743699_1125743708 23 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743708 15:41984951-41984973 AGGCCCCTGTGGGATGTGCATGG 0: 1
1: 0
2: 1
3: 30
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125743699 Original CRISPR CTGGTTCCAGTCGCCCTTCC AGG (reversed) Intronic
900255969 1:1698349-1698371 CTGGTCTCAGTGGCTCTTCCGGG + Intronic
900264637 1:1750959-1750981 CTGGTCTCAGTGGCTCTTCCGGG + Intergenic
901166161 1:7223055-7223077 CTTGTTCCTCTCGCCCTTGCGGG + Intronic
902089718 1:13893337-13893359 CAAGTTCCAGCCACCCTTCCGGG + Intergenic
902956067 1:19924773-19924795 CTGGTGCCAGCCTCCGTTCCAGG + Intergenic
906557836 1:46728509-46728531 CTGGCTTCAGTCTCCCTTCCAGG - Intergenic
907334134 1:53689389-53689411 CTGGTTCCAGTCCTCCCTCCTGG + Intronic
907623767 1:56009412-56009434 CTGCTTCCAGTCGGCCATCTTGG - Intergenic
910799512 1:91131414-91131436 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
912076747 1:105884666-105884688 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
912150500 1:106853413-106853435 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
912449821 1:109761894-109761916 CTGGCTCCAGGGGCCCTTTCCGG + Intronic
913011809 1:114690824-114690846 CTGTTTCCATTTGCCCTTCATGG - Intronic
914967145 1:152270127-152270149 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
914969222 1:152291990-152292012 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
915044320 1:152999419-152999441 CAAGTTCCAGTCACCCTTCCTGG - Intergenic
918684380 1:187396977-187396999 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
921049113 1:211498589-211498611 CTTGTTCCAGAAGCACTTCCAGG - Intergenic
921401405 1:214727625-214727647 CTGGCTTCAGCCCCCCTTCCAGG + Intergenic
922396778 1:225210173-225210195 CTGGTTTCAGCCTCCTTTCCAGG - Intronic
922476388 1:225909745-225909767 CTGGTTCCCGCCACCCTACCTGG + Intronic
923421710 1:233822450-233822472 CTGGTTTCAGCCCCCTTTCCGGG - Intergenic
923853408 1:237820686-237820708 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
924295999 1:242587111-242587133 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1063583555 10:7330912-7330934 CTGCTGCCTGTCCCCCTTCCAGG - Intronic
1068575142 10:58676287-58676309 CTGGCTTCAGCCCCCCTTCCAGG - Intronic
1068595948 10:58903813-58903835 CTGCTTCCAGTCGGCCATCTTGG - Intergenic
1072404386 10:95136345-95136367 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1075545499 10:123351719-123351741 CTGGTTCCAGGCCCAGTTCCTGG - Intergenic
1076017210 10:127037709-127037731 CTGTTTCCAGTGGACCTTCTGGG + Exonic
1076706293 10:132303543-132303565 CAGGTTCCTCTCGCCCTTCCTGG - Intronic
1078743446 11:14090124-14090146 CTGGTTTCAGCCCCCTTTCCAGG + Intronic
1079696102 11:23484184-23484206 CTGGTTTCAGTCCCCTTTCCAGG - Intergenic
1082903621 11:58283264-58283286 CTGGCTTCAGTCGCCTTTCCAGG + Intergenic
1083471260 11:62885582-62885604 CTGGATGCAGCTGCCCTTCCTGG + Exonic
1083703701 11:64498625-64498647 CTGGTTCTACTCACCTTTCCAGG - Intergenic
1084208834 11:67611606-67611628 CTGGTTGCTGTCTCCCTCCCTGG + Intronic
1084787867 11:71453779-71453801 CTGGTCCCCGTGGGCCTTCCTGG + Intronic
1085341102 11:75732175-75732197 CTGCTTCCATTCATCCTTCCAGG - Intronic
1086312389 11:85549280-85549302 CTGCTTCCACTCGCCCTCCTTGG + Intronic
1086732846 11:90271040-90271062 CTGGCTTCAGTCCCCCTTCCAGG + Intergenic
1087069846 11:94067439-94067461 CTGGTCCCAGTCGCCTCTGCAGG + Intronic
1087574046 11:99967768-99967790 TTGCTTCCAGTCTCCCTTCAGGG + Intronic
1087667771 11:101070487-101070509 CTGGCTTCAGCCCCCCTTCCAGG - Intronic
1088642100 11:111882525-111882547 CTGGTTCCAGTTGCCCATCAGGG - Exonic
1088702527 11:112426220-112426242 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1089169805 11:116504067-116504089 CTAGTTCCCCTCGCCCTGCCTGG - Intergenic
1089881747 11:121780714-121780736 CTGATTTCAGTGGCCCTTGCTGG + Intergenic
1092638869 12:10481835-10481857 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1094757836 12:33492732-33492754 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1095831490 12:46591638-46591660 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1096895688 12:54819040-54819062 CTGGTTTCAGCCTCCTTTCCAGG + Intergenic
1097261002 12:57720269-57720291 CTGGGTCCAGCCGCCCTCCAGGG - Intronic
1098052909 12:66472989-66473011 CTGGTTCCTGCCTCCTTTCCAGG - Intronic
1099798032 12:87422634-87422656 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1103851900 12:123938822-123938844 CTGGATGCAGTCGCCATCCCTGG + Intronic
1103899636 12:124296547-124296569 CTGGCTCCACTCCCCTTTCCTGG + Intronic
1105245335 13:18645215-18645237 CTGGTTCCTGTGGCTCCTCCTGG + Intergenic
1109675955 13:65675801-65675823 CTGCTTCCACTTGCCCTTCATGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1114541968 14:23467604-23467626 CAGGTTCAAGTCACCGTTCCTGG + Intergenic
1115465950 14:33714355-33714377 CTGGTTCCAGTCACCGTTCTAGG - Intronic
1115538030 14:34391681-34391703 CTGGCTCCAGCCCCCTTTCCAGG - Intronic
1119421873 14:74512057-74512079 CTGTTGCCACTCTCCCTTCCTGG - Intronic
1121089409 14:91170761-91170783 CTGGTTCCACAGACCCTTCCTGG + Intronic
1125743699 15:41984905-41984927 CTGGTTCCAGTCGCCCTTCCAGG - Intronic
1126302161 15:47209691-47209713 CTGGTCCCCGTCGCCTCTCCAGG + Intronic
1127055656 15:55128547-55128569 CTGGTGCCTGTCTACCTTCCTGG + Intergenic
1127550396 15:60032055-60032077 CTGGTTCCAGCTTTCCTTCCTGG - Intronic
1128647749 15:69389505-69389527 CTGGTGCCATTCCCCCTTCTAGG - Intronic
1131832998 15:96366191-96366213 CTGGGTCTCGCCGCCCTTCCTGG - Intergenic
1132095939 15:98984951-98984973 CTGCTTCCAGATGCCATTCCTGG + Intronic
1132361379 15:101219001-101219023 CAGGCTCCAGTCGGCCTGCCTGG + Intronic
1132379915 15:101359173-101359195 CTGACTCCAGACGCCCTTGCAGG + Intronic
1136177369 16:28526718-28526740 CTGGGTCCAGTCGCCCAGGCTGG + Intergenic
1137296297 16:47097185-47097207 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
1137496341 16:48972006-48972028 CTGGTTCCAGGAGGCCTGCCTGG - Intergenic
1138843675 16:60539251-60539273 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1140472261 16:75222560-75222582 CTGGCTCCAGTCATCCTTCCAGG - Intronic
1144727962 17:17511272-17511294 CTGGCTGCTGTCCCCCTTCCTGG + Intronic
1145892510 17:28427052-28427074 CTGGTTGCAGTGGCTCATCCCGG + Intergenic
1148565097 17:48627833-48627855 CTGGTTGCAGTCGCCTCTCCTGG + Intronic
1149016187 17:51911100-51911122 GTGGTTCCACTTGCCCCTCCAGG + Intronic
1151064207 17:71131971-71131993 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1151750797 17:76036510-76036532 CTGGCTCCAGTCCCTCCTCCAGG - Intergenic
1152561944 17:81083034-81083056 CCGGGTCCTCTCGCCCTTCCAGG - Intronic
1153141967 18:1983071-1983093 CTGTTTGCAGTCAGCCTTCCTGG + Intergenic
1154443611 18:14414732-14414754 CTGGTTCCTGTGGCTCCTCCTGG - Intergenic
1157222512 18:45837991-45838013 CTGGGTCTCGTTGCCCTTCCTGG - Intronic
1157546973 18:48553470-48553492 CTGGTTACAGTCTGCATTCCGGG - Intronic
1158229211 18:55234683-55234705 CTGGTTCCTCTCGCCCTTTCAGG - Exonic
1159254702 18:65931098-65931120 CTGGCTTCAGTTGCCTTTCCAGG - Intergenic
1161919484 19:7255384-7255406 CTGGTCCAAGCCTCCCTTCCCGG + Intronic
1162722531 19:12670813-12670835 CTGGCTCCACTCACCCTGCCAGG - Exonic
1164123162 19:22286429-22286451 CTGGTTGCAGCCGCAGTTCCCGG + Exonic
1165254611 19:34568193-34568215 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
926043778 2:9694727-9694749 ATGGTTCCAGTCTCTCTTCCCGG - Intergenic
929837998 2:45426012-45426034 CTGGCTCCAGCCCCCTTTCCAGG - Intronic
930439901 2:51391837-51391859 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
931212110 2:60207308-60207330 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
936091982 2:109507353-109507375 CTGTTTCATGTCACCCTTCCAGG + Intergenic
937143110 2:119618749-119618771 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
937465044 2:122125108-122125130 CTGGCTTCAGTCCCCCTTCCAGG + Intergenic
937562703 2:123244924-123244946 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
939100524 2:137890337-137890359 CTGGTTCCTGTGGCTCCTCCTGG + Intergenic
940821383 2:158359837-158359859 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
941392200 2:164927913-164927935 CTGATGCCAGTCACTCTTCCAGG - Intronic
941518743 2:166511556-166511578 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
943105683 2:183543707-183543729 CTGGCTTCAGCCCCCCTTCCAGG - Intergenic
943660461 2:190554318-190554340 CTGGCTTCAGTCTCCTTTCCAGG - Intergenic
943836799 2:192524636-192524658 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
947364659 2:229381440-229381462 CTGGTTGCAGCCACCTTTCCAGG - Intronic
1168841135 20:910885-910907 CTGTTTCCAGGCCCCCTTCTTGG + Intronic
1169974968 20:11314268-11314290 ATGGTACAAGTGGCCCTTCCTGG + Intergenic
1173401257 20:42728038-42728060 CTGGCTCCAGACGACCTTCCAGG + Intronic
1173736222 20:45363446-45363468 TTGGTTCCAGTCCCTCCTCCCGG + Intronic
1175287975 20:57850608-57850630 ATGGTTGCAGTGGCTCTTCCTGG + Intergenic
1176232264 20:64038545-64038567 CTGGGTCGCGTCTCCCTTCCCGG + Intronic
1176452477 21:6876506-6876528 CTGGTTCCTGTGGCTCCTCCTGG + Intergenic
1176830650 21:13741555-13741577 CTGGTTCCTGTGGCTCCTCCTGG + Intergenic
1177184210 21:17775719-17775741 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1178612458 21:34096270-34096292 CTGGTTCCTGTGGGCCTTCGGGG + Exonic
1184182660 22:42841202-42841224 CTGGCTCCTCTCGTCCTTCCTGG + Intronic
951237731 3:20254666-20254688 CTGGTTCCAGCCCCCTCTCCAGG + Intergenic
953020935 3:39112614-39112636 CTGGTTCCAGTGGCCTGGCCAGG - Intronic
954508215 3:51097583-51097605 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
954787025 3:53101277-53101299 CTGGTCCCCGCCTCCCTTCCTGG - Intronic
957474825 3:80709593-80709615 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
959734958 3:109648062-109648084 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
961768638 3:129231862-129231884 CTGGTCCCAGTCTGCCTCCCTGG - Intergenic
962269976 3:133970367-133970389 CTGGTTCCAGTAGACCATTCAGG + Intronic
962765691 3:138560535-138560557 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
962898111 3:139734090-139734112 GTGGTGCCATTTGCCCTTCCAGG - Intergenic
963027359 3:140933225-140933247 CTGCTTCCACTCGCCCTCCGTGG - Intergenic
964010347 3:151885305-151885327 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
964053279 3:152421326-152421348 CTGGCTTCAGCCGCCTTTCCAGG - Intronic
967343560 3:188427889-188427911 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
967715562 3:192758209-192758231 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
968717971 4:2175846-2175868 CTGGTTCCCTTTGCCCTCCCTGG + Intronic
968814917 4:2817325-2817347 CTCCTTCCAGCCGCCCTGCCAGG - Intronic
970494170 4:16608957-16608979 CTGTTTCCAGTCGGCCGTCTTGG - Intronic
971673625 4:29595653-29595675 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
972253004 4:37324754-37324776 CTGGTTCCTGTCACTCTGCCAGG + Intronic
972347301 4:38203311-38203333 CTGGTACCAGTGGGCGTTCCGGG + Intergenic
974560067 4:63506108-63506130 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
976363041 4:84202774-84202796 CTGGCTTCAGTCTCCTTTCCAGG - Intergenic
977792919 4:101128910-101128932 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
978699787 4:111628430-111628452 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
979482377 4:121234815-121234837 ATGTTTCCAGTGGCCCTTCAAGG - Intergenic
979819404 4:125151831-125151853 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
979965999 4:127077318-127077340 CTGGCTCCAGCCCCCTTTCCTGG + Intergenic
981748282 4:148071265-148071287 CTGGCTCCAGCCGCCCCTCCAGG - Intronic
981989486 4:150900265-150900287 CTGTTTCCAGTAACACTTCCAGG + Intronic
982915551 4:161204090-161204112 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
983167718 4:164497694-164497716 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
983270433 4:165555057-165555079 CTAATTCCTGTCTCCCTTCCAGG + Intergenic
984146265 4:176065502-176065524 CTGGTTCAAGTCCCTCCTCCAGG + Intergenic
987399954 5:17464426-17464448 CTGTTTCTAGTCGGCCATCCTGG + Intergenic
992506099 5:77389049-77389071 CTGGCTTCAGTCTCCTTTCCAGG + Intronic
994918063 5:106004849-106004871 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
995301899 5:110594469-110594491 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
995480340 5:112586499-112586521 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
998374683 5:141682633-141682655 CAGGGTCCAGCCACCCTTCCGGG - Intergenic
998807559 5:145933755-145933777 CTGGATCTAGTCTGCCTTCCTGG + Intergenic
999502402 5:152160285-152160307 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
999602572 5:153283062-153283084 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
999688299 5:154122318-154122340 CTGGCTTCAGTCCCCTTTCCAGG - Intronic
1000142321 5:158417478-158417500 CTGGTTGCAGTCTCTCTTTCTGG + Intergenic
1001551310 5:172604052-172604074 GTGGTCCCAGTGGCCCTTCCAGG + Intergenic
1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG + Intronic
1003122144 6:3327162-3327184 ATGGTTCCAGTCGCCTGGCCAGG + Intronic
1004027971 6:11837351-11837373 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1004548863 6:16627153-16627175 CTGGTTCCAGTCTGACTTCTTGG + Intronic
1004808981 6:19238857-19238879 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1005587730 6:27293318-27293340 GTGGTTCTAGTCACCATTCCAGG - Intronic
1006149691 6:31980245-31980267 CTTGTTCCAGGCCCCCTACCTGG - Intronic
1007724918 6:43909873-43909895 CTGGATCCAGTCCTGCTTCCAGG - Intergenic
1009305922 6:62089198-62089220 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1011020720 6:82809470-82809492 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1011578167 6:88827554-88827576 CTGGCTTCAGCCGCCTTTCCAGG - Intronic
1011831262 6:91374687-91374709 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1012922440 6:105233981-105234003 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1013037971 6:106405046-106405068 CTGGTTTCAGTCCCCTTTCCAGG - Intergenic
1013272789 6:108559355-108559377 CTGGTACCAGGCGCCCTGCCCGG + Intergenic
1013964190 6:115935511-115935533 CTGGCTTCAGCCCCCCTTCCAGG - Exonic
1015211297 6:130701782-130701804 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1016483512 6:144508215-144508237 CTGGCTTCAGTCCCCTTTCCAGG + Intronic
1018108692 6:160513851-160513873 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1019477263 7:1249919-1249941 CTGGTTCCAGCCTCACTCCCTGG - Intergenic
1020106719 7:5425623-5425645 CAGTTTCAAGTTGCCCTTCCTGG + Intergenic
1020608617 7:10367714-10367736 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1024226495 7:47329776-47329798 CTGGTCACAGTCACCCTTCCTGG - Intronic
1024229373 7:47352680-47352702 TTGGTTCCTGGCTCCCTTCCAGG + Intronic
1024495425 7:50040820-50040842 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
1027232277 7:76279766-76279788 ATGGTGCCAGATGCCCTTCCTGG + Intronic
1028142390 7:87288386-87288408 CTGGCTCCAGCCCCCTTTCCAGG + Intergenic
1028997586 7:97117957-97117979 CTAGTTCCAGTCCCCCATGCGGG + Intronic
1029324782 7:99796701-99796723 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1029612028 7:101631512-101631534 CTCGTTCCAAGCTCCCTTCCTGG - Intergenic
1030366705 7:108654964-108654986 CTGGTTCCAATTGCTCTTCAAGG - Intergenic
1031348680 7:120701376-120701398 CTTGTTCCAGTCTCCCTATCAGG - Intronic
1031999816 7:128257633-128257655 TTGTTTCCTGTCGCCGTTCCTGG + Intergenic
1032327597 7:130945773-130945795 ATGGTTCCAGTCCCTCTTCCTGG + Intergenic
1033617640 7:143032177-143032199 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1034954110 7:155322800-155322822 CAGGTTCCTCTCGCCCTTTCTGG - Intergenic
1035623399 8:1052163-1052185 CTGGGCCCGGCCGCCCTTCCTGG + Intergenic
1041323326 8:56637294-56637316 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1041630593 8:60082912-60082934 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1041900651 8:62978693-62978715 CTGGTTTCAGCCCCCTTTCCAGG + Exonic
1044940278 8:97335117-97335139 CTGGTTTCATTCCCCTTTCCAGG + Intergenic
1046014607 8:108590224-108590246 CTGGCTTCAGCCGCCTTTCCAGG - Intergenic
1046153500 8:110257856-110257878 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1047121280 8:121908083-121908105 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1050750637 9:8932848-8932870 CTGGCTTCCGTCGCCTTTCCAGG + Intronic
1050973933 9:11912388-11912410 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1051823070 9:21191370-21191392 CAGGTTCCAGTCGGCCATCTTGG - Intergenic
1051824898 9:21209907-21209929 CAGGTTCCAGTCGGCCATCTTGG - Intronic
1053608181 9:39681368-39681390 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1053866022 9:42437728-42437750 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1054245350 9:62661041-62661063 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1054559478 9:66695572-66695594 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1054889105 9:70232660-70232682 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1055239207 9:74163658-74163680 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1060101457 9:120843966-120843988 CTGGTTGCAGAGGGCCTTCCGGG - Intergenic
1062677382 9:137754861-137754883 CAGGTTCCAGTCACCCATGCGGG - Intronic
1203516704 Un_GL000213v1:8009-8031 CTGGTTCCTGTGGCTCCTCCTGG - Intergenic
1188664618 X:32804139-32804161 CTGGTTTCAGCCCCCTTTCCAGG - Intronic
1188893311 X:35636340-35636362 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1189575128 X:42343348-42343370 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1190505855 X:51125389-51125411 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1190739793 X:53281380-53281402 CTGGTTCCTGGCTCCCTTCTTGG - Intronic
1191094369 X:56659129-56659151 CTGGCTTCAGTCCCCTTTCCAGG + Intergenic
1192701803 X:73482302-73482324 CTGGTTTCAGACCCCTTTCCAGG + Intergenic
1193040480 X:76998956-76998978 CTGGTTTCAGCCCCCTTTCCAGG + Intergenic
1193356014 X:80521173-80521195 CTGGTTTCAGTCCCCTTTCCAGG + Intergenic
1193376379 X:80766777-80766799 CTGCTTCCACTCGCCCTCCGAGG - Intronic
1194334122 X:92624805-92624827 CTGGTTCCAGAATCCCATCCAGG + Intergenic
1194643424 X:96429565-96429587 CTGGCTTCAGCCCCCCTTCCAGG + Intergenic
1197319086 X:125006030-125006052 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1197770843 X:130088291-130088313 CTGGTTCCAGCTACCCTACCTGG - Intronic
1198518973 X:137433540-137433562 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1199401598 X:147405428-147405450 CTGGTTTCAGCCCCCTTTCCAGG - Intergenic
1199742193 X:150745900-150745922 CTGGTTCCACAAGCCCTTCTGGG + Intronic
1200642805 Y:5743799-5743821 CTGGTTCCAGAATCCCATCCAGG + Intergenic
1201611854 Y:15851881-15851903 CTGGCTTCAGTCCCCTTTCCAGG - Intergenic
1202092428 Y:21208262-21208284 CTGTTTCTAGTCACCCATCCTGG - Intergenic
1202301185 Y:23416188-23416210 CTGGCTGCAGTGGCTCTTCCTGG + Intergenic
1202569626 Y:26254410-26254432 CTGGCTGCAGTGGCTCTTCCTGG - Intergenic