ID: 1125743699

View in Genome Browser
Species Human (GRCh38)
Location 15:41984905-41984927
Sequence CTGGTTCCAGTCGCCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125743699_1125743704 12 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743704 15:41984940-41984962 CAGAGCTGCCCAGGCCCCTGTGG 0: 1
1: 8
2: 10
3: 89
4: 539
1125743699_1125743705 13 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743705 15:41984941-41984963 AGAGCTGCCCAGGCCCCTGTGGG 0: 1
1: 0
2: 2
3: 40
4: 308
1125743699_1125743702 3 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743702 15:41984931-41984953 ATACACAGCCAGAGCTGCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 223
1125743699_1125743708 23 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743708 15:41984951-41984973 AGGCCCCTGTGGGATGTGCATGG 0: 1
1: 0
2: 1
3: 30
4: 281
1125743699_1125743709 24 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743709 15:41984952-41984974 GGCCCCTGTGGGATGTGCATGGG 0: 1
1: 0
2: 0
3: 19
4: 163
1125743699_1125743713 30 Left 1125743699 15:41984905-41984927 CCTGGAAGGGCGACTGGAACCAG 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1125743713 15:41984958-41984980 TGTGGGATGTGCATGGGCTTTGG 0: 1
1: 0
2: 3
3: 32
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125743699 Original CRISPR CTGGTTCCAGTCGCCCTTCC AGG (reversed) Intronic