ID: 1125743840

View in Genome Browser
Species Human (GRCh38)
Location 15:41985944-41985966
Sequence CAGCAGGCACAGGTGGTTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125743834_1125743840 22 Left 1125743834 15:41985899-41985921 CCTGAGGAGGGGCGGGTAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 249
Right 1125743840 15:41985944-41985966 CAGCAGGCACAGGTGGTTCGCGG 0: 1
1: 0
2: 0
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125743840 Original CRISPR CAGCAGGCACAGGTGGTTCG CGG Exonic
900332795 1:2144573-2144595 CAGCAGGCTCAGGTAGGACGTGG + Intronic
900537880 1:3187716-3187738 CAGCAGGCAGATGTGGTCCTTGG + Intronic
901084568 1:6602752-6602774 CAGCAGGCTCAGGGCGTGCGCGG + Exonic
901376475 1:8843243-8843265 CAGCAGGCACTGGAGGCTCTCGG - Intergenic
901451705 1:9339999-9340021 CTGCATGCCCAGGTGGTTCAGGG - Intronic
901517543 1:9759041-9759063 CAGCAGCCACATGTGGCTGGTGG + Intronic
901890738 1:12261572-12261594 CAGTAGCCACATGTGGTTAGTGG + Intronic
901900708 1:12359416-12359438 CAGCAGCCACATGTGGCTAGTGG - Intronic
902917577 1:19647979-19648001 TAGGGGGCACAGGTGGTTTGGGG + Intronic
903737984 1:25542537-25542559 CAGCATGCTCAGGTGGTGCCAGG + Intergenic
904676587 1:32202422-32202444 CAGGAACCACAGGTGGTTTGGGG + Intronic
905804236 1:40864182-40864204 CAACAGTCACAGCTGGTTGGTGG - Intergenic
908771185 1:67597886-67597908 CAGTAGGCACAAGTGGTTAGTGG + Intergenic
908865600 1:68546106-68546128 CAGTAGGCACATGTGATTAGTGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
912430668 1:109626890-109626912 CAGCAGACACAGGGGTGTCGGGG - Exonic
913097182 1:115529570-115529592 CAGCAGTCACAGGAGGTAAGGGG + Intergenic
913364458 1:118021103-118021125 CAGCAGGAACAGTTGCTTTGTGG + Intronic
914942223 1:152033326-152033348 CAGCAGACACATGTGGCTGGTGG + Intronic
915278810 1:154808379-154808401 TAGCAGGTGCAGGTGGGTCGAGG - Intronic
915631155 1:157154945-157154967 CTGCAGGCAGAGGTGGGTAGGGG - Intergenic
919704337 1:200662029-200662051 CAGAAGGCAGAGGGGGTGCGAGG - Intronic
919905450 1:202075457-202075479 CAGCAGGCACAAGTCCTTCAGGG + Intergenic
920127499 1:203705036-203705058 CAGCAGCCACATGTGGTGAGTGG - Intronic
920373016 1:205491680-205491702 CAGCAGGCCCAGGTGGGGTGGGG - Intergenic
920417717 1:205810013-205810035 CAGCAGGCAAAGGTGGCCCTGGG + Intronic
920502294 1:206493037-206493059 AACCAGGCGCAGGTGGTTCCTGG - Exonic
924358736 1:243213174-243213196 CAACAGGCACACATGGTTAGTGG + Intronic
1063241791 10:4177353-4177375 CAGCAGGCTCAGTTGGTTCCAGG - Intergenic
1064382170 10:14854810-14854832 AAGCAGCCACAGGTGGCTAGTGG - Intronic
1065136666 10:22677509-22677531 CAGCAGCCACACGTGGCTCGTGG + Intronic
1065787564 10:29230374-29230396 TAGGAGGCAGAGGGGGTTCGGGG - Intergenic
1066350536 10:34632897-34632919 CAGTGGCCACAGGTGGCTCGGGG + Intronic
1066583266 10:36903646-36903668 CACCAGGCCCAGGTGGTCTGAGG + Intergenic
1067427287 10:46219899-46219921 CAGCAGGCACAGGGGCTGAGAGG - Intergenic
1067582720 10:47455784-47455806 CAGCAGGCACAGGGGCTGAGAGG - Intergenic
1072425512 10:95326802-95326824 CAGCAGCCACAGGTGGCTGTTGG + Intronic
1072764880 10:98087305-98087327 CAGCAGGCAGAAGTGGCTTGTGG - Intergenic
1072958604 10:99908942-99908964 CAGCAGGCACAGGTGGGAACTGG - Exonic
1074567908 10:114597943-114597965 CAGTAGCCACATGTGGTTAGTGG - Intronic
1074690503 10:115999981-116000003 CAGTAGTCACAAGTGGTTAGTGG - Intergenic
1076289950 10:129337737-129337759 AAGCAGGCTCTGCTGGTTCGTGG - Intergenic
1076638501 10:131899058-131899080 CAGAAGGCACAGCTGGGTGGGGG - Intergenic
1077013200 11:388663-388685 CAGCAGTCACAGGTGTATCTAGG - Intergenic
1078141752 11:8698265-8698287 CAGGAGGCACAGTTGGCTTGGGG + Intronic
1078335896 11:10462895-10462917 CAGAAGGCCCATGTGGTTAGAGG + Intronic
1079513868 11:21243775-21243797 CAGCAGCCACCTGTGGTTAGTGG + Intronic
1080062604 11:27972967-27972989 CAGCAGGCACAGATGGCTAGTGG - Intergenic
1083448140 11:62724374-62724396 CAGCAGGCTCAGATGGTGAGCGG - Exonic
1083482647 11:62959653-62959675 CAGCAAGGACAGGTGGCTGGAGG - Intronic
1084312582 11:68325489-68325511 CAGGTGGCACAGGTGGCTTGGGG + Intronic
1084749324 11:71193784-71193806 CTGCAGGCACAGATTGTTCCAGG + Intronic
1084962961 11:72726840-72726862 TGGCAGGCACAGGTGGTGAGCGG + Exonic
1085783601 11:79431995-79432017 CAACAGCCACATGTGGTTAGTGG - Intronic
1085903926 11:80737168-80737190 CACCAGGCCCAGGTGGTTTGAGG - Intergenic
1088599579 11:111462693-111462715 CAGGAGGCACAGGTGGTGCTAGG + Intergenic
1089627577 11:119761435-119761457 CAGCAGACAGAGGTGGTGGGAGG - Intergenic
1089697855 11:120226834-120226856 CGGCAGGCGGAGGAGGTTCGGGG + Exonic
1089729856 11:120512745-120512767 CAGCTGGGACAGGGGGTTCAAGG + Intronic
1090407233 11:126483988-126484010 CAGCAGGTACATGTGGTGCCTGG + Intronic
1091411321 12:241483-241505 AAACAGCCACAGGTGGCTCGTGG - Intronic
1091601122 12:1918303-1918325 CAGCAGCCACAGGAGGGCCGAGG + Exonic
1094067645 12:26378332-26378354 CAGAAGGCACACGTGGGCCGAGG + Intronic
1094215195 12:27933050-27933072 CAGTAGCCACATGTGGCTCGTGG - Intergenic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1098429978 12:70408568-70408590 CGGCAGGCACAGCTGCTTCGGGG - Intronic
1098502312 12:71207170-71207192 CAGCAGGCACATGGGGTTTTAGG - Intronic
1101605261 12:106243637-106243659 CAGCAGGCACAAGTGGGTCCTGG - Intronic
1104420617 12:128631669-128631691 CTTCAGGCACAGTTGGTTCCAGG + Intronic
1104553722 12:129780700-129780722 CAGCAGGTACAGGGGGCTTGTGG - Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1105294601 13:19076701-19076723 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1105949248 13:25214681-25214703 CAGCAGGCACAGCCAGTTCTAGG + Intergenic
1112661292 13:101511699-101511721 CAGCAACCACAGGTTGTTTGTGG - Intronic
1113812968 13:113153490-113153512 CAGCAGGCACAGCTGGGTCCAGG + Intergenic
1116437956 14:44914963-44914985 CAGCAGGCGCAGATAGTTCTAGG + Intergenic
1117355233 14:54917610-54917632 CAGCAGGCACACATGGCTAGTGG - Intergenic
1118639125 14:67776035-67776057 CAGCATGAACAGGGGGTTAGAGG + Exonic
1119200833 14:72751557-72751579 CAGTAGCCACAGGTGGCTAGTGG - Intronic
1121673412 14:95731584-95731606 CTGCAGGCATAGGTGGTAGGAGG + Intergenic
1122138189 14:99646361-99646383 CAGCAGGGGCAGGTGGTGTGGGG + Intronic
1122279503 14:100612977-100612999 CAGCAGGCACGTGTGGTTGGTGG - Intergenic
1125144406 15:36450015-36450037 CAACAGGCACATGTGGCTAGTGG - Intergenic
1125677018 15:41507527-41507549 TAGCAGGCACAGTTGATTCAAGG - Intronic
1125743840 15:41985944-41985966 CAGCAGGCACAGGTGGTTCGCGG + Exonic
1127570587 15:60237354-60237376 CAGGAAGCACAAGTGGTTGGGGG + Intergenic
1129079155 15:73024113-73024135 CAGCAGCCAGAGGTGCTTCTGGG + Intergenic
1129585769 15:76863147-76863169 CAGCTGGCACAGGGTGTTGGTGG - Intronic
1129920524 15:79315751-79315773 AGGCAGGCACAGATGGTTCAAGG - Intronic
1130069818 15:80636945-80636967 CAGCAGGCAAGGCTGGTTCTGGG - Intergenic
1130962864 15:88675615-88675637 CAGCAGCCACATGTTGTTAGTGG - Intergenic
1131217528 15:90551491-90551513 CAGGAGGCACATGTGGCTGGTGG + Intronic
1132270636 15:100520808-100520830 CAGCAAGCACAGCTGGTGCCGGG + Intronic
1132484678 16:184438-184460 CAGGAGGCAAAGGTGGTACAAGG + Intergenic
1132745113 16:1433258-1433280 CAGCAGGCCCAGGGGGCTAGGGG - Intergenic
1133155215 16:3869655-3869677 CAACAGCCACACGTGGCTCGTGG + Intronic
1133272288 16:4616137-4616159 CAGCAGCCTCTGGTGCTTCGGGG + Intergenic
1134429638 16:14191238-14191260 CAGCAGCCACATGTGGCTAGTGG + Intronic
1136019472 16:27430866-27430888 TAGCAGGCACTGGTGGTCCCTGG + Intronic
1139690451 16:68638344-68638366 CAGGAGGCGCAGGTGTGTCGGGG + Intronic
1140832239 16:78762589-78762611 CAGTGGGCACAGGGGGCTCGGGG + Intronic
1141305367 16:82857864-82857886 CAGTAGCCACCGGTGGTTCATGG + Intronic
1141371253 16:83488168-83488190 CAGCAGTCATATGTGGTTGGTGG + Intronic
1142374683 16:89700960-89700982 CAGCAGGTACAGGTGCACCGCGG + Exonic
1143195415 17:5072617-5072639 CAGGAGGCACTGGTGGTGCTGGG - Intergenic
1144872115 17:18377969-18377991 CAGCAAGCACAGCTGGTGAGTGG + Exonic
1144947526 17:18977573-18977595 AAGGAGGCACAGGTGGGTCAGGG - Exonic
1145061518 17:19737228-19737250 GAGCAGGCACAGGTGGGGCCAGG + Intergenic
1147590734 17:41681854-41681876 CAGAAGCCACAGGTGGCTTGTGG + Intergenic
1148699732 17:49580189-49580211 CAGCGGGCACGGGTGGGGCGGGG + Exonic
1149192939 17:54085827-54085849 CAGAAGGCACAAGGGGTTGGGGG + Intergenic
1150519396 17:65850420-65850442 CAGCATTCACTGTTGGTTCGTGG - Intronic
1151381556 17:73729281-73729303 CAGTAGTCACACGTGGTTTGTGG + Intergenic
1151749171 17:76027093-76027115 CAGCAGGCACAGCCGGTAAGTGG - Exonic
1152656143 17:81519976-81519998 CAGCAGGAAAAGGTGGCTCCAGG + Intronic
1152855564 17:82663285-82663307 CTGGAGGCACACGTGGCTCGGGG + Intronic
1153157296 18:2164096-2164118 CAGCATACACAGGTGATTCAAGG + Intergenic
1153274430 18:3354022-3354044 CAGTAGCCACATGTGGTTGGTGG + Intergenic
1158425299 18:57334587-57334609 CAGCAAGCACAGAAGGTGCGGGG - Intergenic
1159680014 18:71337853-71337875 CAGTAGTCACACGTGGTTAGTGG - Intergenic
1159898436 18:74019503-74019525 CAGCAGGCACAGGAAGCACGGGG + Intergenic
1160143376 18:76346097-76346119 CAGGAAGCACAGGTGCTTCGCGG + Intergenic
1161012921 19:1968864-1968886 CAGCAGCCACTGGTGGAGCGGGG - Intronic
1161067938 19:2247723-2247745 CAGCAGGCACGGGTGGGGCTAGG - Intronic
1161729636 19:5951467-5951489 CAGCAGGGGCAGGAGGTTCTAGG + Exonic
1162621842 19:11849626-11849648 TAGGAGGCACAGGTGGTTGAGGG + Intronic
1162626539 19:11889023-11889045 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162630911 19:11925999-11926021 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162635774 19:11965928-11965950 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162638753 19:11990520-11990542 TAGAAGGCACAGGTGGTTGAGGG + Intergenic
1162659052 19:12155477-12155499 TAGAAGGCACAGGTGGTTGAGGG - Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167758152 19:51426313-51426335 GAGCAGGAACAGGCGGTACGGGG + Intergenic
925159471 2:1673900-1673922 CAGCAGGCACAACTTGTGCGAGG + Intronic
925749803 2:7077796-7077818 CAGCAGGCTCAGGTGGTCAGTGG + Intergenic
926131099 2:10303551-10303573 CAGCAGGGACAGGGGGCTCTGGG - Intronic
926226249 2:10968838-10968860 CTGCAGGCAGAGGTGAGTCGGGG - Intergenic
927463989 2:23323570-23323592 CAGGAGGCAGAGCTGGGTCGGGG + Intergenic
929748053 2:44679764-44679786 CAACATGCACAGTTGGTTCATGG + Intronic
929793173 2:45038580-45038602 CAGCAGGGAAAGGTGGATCTGGG + Intergenic
930719945 2:54629165-54629187 CAGCAAGCACCGGGCGTTCGAGG + Exonic
931283094 2:60810680-60810702 CAGGAGGCACAGATCGTTGGGGG - Intergenic
931461263 2:62452384-62452406 CAGCAGGCCCAGGTAGTTAAAGG - Intergenic
932121820 2:69108065-69108087 CAGCAGCCACATGTGGCTTGTGG - Intronic
933633955 2:84686694-84686716 CAGCAGGCAGATGTGGCTCATGG - Intronic
934615858 2:95770329-95770351 CATCAGGCACACATGGTTAGTGG - Intergenic
934645037 2:96054229-96054251 CATCAGGCACACATGGTTAGTGG + Intergenic
934838444 2:97610318-97610340 CATCAGGCACACATGGTTAGTGG + Intergenic
935115547 2:100132679-100132701 CAGCAGTCACATGTGGTTAGTGG - Intronic
943445983 2:187988499-187988521 CACCTGGCACAGGTGGTACAAGG - Intergenic
946170960 2:217895255-217895277 GAGCAGGCACAGGAGGTCCAGGG - Intronic
948004893 2:234600054-234600076 CACCAGCCACAGGTGGCTCCTGG + Intergenic
948311924 2:236993890-236993912 CAGCAGGCACAGGGGTTTGAAGG - Intergenic
948319030 2:237054544-237054566 CAGTAGTCACGGGTGGTTAGTGG - Intergenic
948468743 2:238164306-238164328 GAGCAGGCGCAGGTGGTCCCGGG - Exonic
1168960277 20:1864311-1864333 CAGCTGGGACAGGTGGGTCATGG + Intergenic
1169822772 20:9731470-9731492 CAGTAGCCACATGTGGTTAGTGG + Intronic
1170974575 20:21150202-21150224 CAAGAGGCACAGGTGCTTAGAGG + Intronic
1171879181 20:30604045-30604067 AAGCAGGCACAGCTGGTGCCAGG - Intergenic
1172132823 20:32667100-32667122 CAGCAGCCACAGATGGTCAGTGG + Intergenic
1173200395 20:40950527-40950549 CAGTAGCCACATGTGGCTCGTGG + Intergenic
1173622969 20:44450590-44450612 CAGAAGGCACAGGTGCCTCCAGG - Intergenic
1173635360 20:44551670-44551692 CAACAGGCACAGCTGGCTAGAGG - Intronic
1173653972 20:44686199-44686221 CAGCAGCCACATGTGGTGGGTGG - Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1179663970 21:42896936-42896958 CAGGAAGCCCAGGTGTTTCGAGG + Exonic
1180162616 21:46005100-46005122 GAGCAGTCACAGGAGGTTGGGGG + Intergenic
1180215822 21:46323483-46323505 CTGCAGGTCCAGGCGGTTCGCGG + Exonic
1181808966 22:25392028-25392050 CAGGTGGCACAGGTGGCTTGGGG - Intronic
1181952705 22:26566078-26566100 CTGCAGCCACACGTGGTTTGTGG + Intronic
1181975941 22:26729828-26729850 CAGCAGTCACATTTGGTTTGTGG - Intergenic
1182461223 22:30485433-30485455 CACCAGGCCCAGGCTGTTCGTGG - Intergenic
1182642942 22:31782981-31783003 CAGGAGGCAAAGGTGGTGAGAGG + Intronic
1184074644 22:42168598-42168620 CAGCAAGCACAGGTGAGTCGGGG - Exonic
1184150527 22:42635773-42635795 CAGCAGGCACAGGAGGGGTGTGG - Intronic
1184173178 22:42771488-42771510 CAGCAGCCACAGGTGTCTCAGGG - Intergenic
1185094868 22:48800701-48800723 CAGCAGACACAGGTGGCTGGAGG + Intronic
1185228682 22:49668025-49668047 CAGCAGGCGCAGGTGGGAGGAGG + Intergenic
954196577 3:49000687-49000709 CACCAGGCACAGCTGGTAGGTGG - Intronic
954387518 3:50252071-50252093 CAGAGGGCACAGGTGGTCAGGGG - Intronic
955513104 3:59700720-59700742 CAGAAGGCAGAGGTGGTCCATGG + Intergenic
956430839 3:69184799-69184821 CAGCAGCCACATGTGGCTAGTGG - Intronic
957606797 3:82410146-82410168 CAATAGCCACATGTGGTTCGTGG - Intergenic
958731842 3:97968213-97968235 GAGCAGGTTCAGGTGGTTAGTGG - Intronic
960623643 3:119659944-119659966 CAGCAGGGACAGGCGGTTGATGG + Exonic
960702790 3:120453092-120453114 TAGAAGGCACAGGAGGTTTGAGG + Intergenic
961443291 3:126965700-126965722 CAGCAGGCACAGTTTGTTACTGG - Intergenic
963027129 3:140931092-140931114 CAGCAGGAATAGGTGGTGGGAGG + Intergenic
963707807 3:148710058-148710080 CAGTAGACACATGTGGTTAGTGG + Intronic
966481318 3:180412166-180412188 CAGCATGCACAAGTTGTTGGGGG - Intergenic
967333915 3:188321260-188321282 CAACAGCCACATGTGGTTAGTGG - Intronic
968008019 3:195256042-195256064 CAGCAGGCACAGGGGCACCGTGG + Intronic
968577393 4:1374292-1374314 CAGGAGGCACAGGAGGTGCCAGG - Intronic
968731159 4:2270005-2270027 CCGCAGGCAGAGGTTGCTCGGGG - Exonic
968762742 4:2450900-2450922 CAGCAGGCACAGGTGCCAGGCGG + Intronic
968867549 4:3223343-3223365 CTGCAGGCAGAGGTGGTTGTGGG + Intronic
969055935 4:4402763-4402785 CACCAGGCACAGGAAGTGCGGGG - Intronic
969313716 4:6369242-6369264 CAGCAGGCACATGGGGCTGGTGG + Intronic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
970155680 4:13139686-13139708 CAGCAGAGACAGGTGGCTCTTGG - Intergenic
971297004 4:25403730-25403752 CAGCAGCCACAAATGGTTAGTGG + Intronic
973585598 4:52387782-52387804 CAGGAGGCAGAGATGGTTGGGGG - Intergenic
974515799 4:62908317-62908339 TAGCATGCACAGGTGGTGTGAGG + Intergenic
979689662 4:123547167-123547189 CTGCAGGCACATGTAGTTGGGGG - Intergenic
980716589 4:136637171-136637193 CAGCAGGCACGCGTGGCTCAGGG + Intergenic
981104925 4:140869756-140869778 CAGCATGTACAGGTGGCTGGAGG + Intronic
981363581 4:143875452-143875474 CAGCAGGTGCAGCTGGTTCTAGG + Intronic
981383416 4:144099511-144099533 CAGCAGGTGCAGCTGGTTCTAGG + Intergenic
988427064 5:31076086-31076108 CAGTAGCCACATGTGGTTAGTGG + Intergenic
988863743 5:35311906-35311928 CAAAAGCCACAGGTGGTTAGTGG + Intergenic
990170374 5:53041589-53041611 CAGTAGTCACATGTGGCTCGTGG - Intronic
992856973 5:80871841-80871863 CAGCAGGCAGAGGTCTTTGGTGG + Intronic
992882349 5:81123037-81123059 CAGCAGCCACATGTGGCTAGTGG - Intronic
993095281 5:83472940-83472962 CTGCAGACAAAGGTGGCTCGGGG + Intronic
1000022423 5:157329780-157329802 CAGTAGGCACATGTGGCTGGTGG + Intronic
1000392402 5:160737994-160738016 CAGCAGGCACAGTTTTTTCAAGG + Intronic
1003366998 6:5484450-5484472 CACCAGTCACATGTGGTTAGTGG - Intronic
1004134643 6:12954921-12954943 CAGTAGCCACATGTGGTTAGTGG - Intronic
1004442722 6:15669470-15669492 CTCCAGGCACAGTTGGTTCTTGG - Intergenic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1005887714 6:30109493-30109515 CAGTAGCCACATGTGGTTGGTGG - Intronic
1006552848 6:34839435-34839457 CAGTAGTCACACGTGGTTAGTGG - Intronic
1007494541 6:42250628-42250650 CAGCATGCACACAGGGTTCGTGG + Intronic
1009034837 6:58104463-58104485 CAGTAGCCACATGTGGTTTGTGG - Intergenic
1012536092 6:100298685-100298707 CAGGAGGCAGAGGTGGTGAGCGG + Intergenic
1013368228 6:109450267-109450289 CAGGAGGCACAGGGGTTTCATGG - Intronic
1015564700 6:134556886-134556908 CAGTAGCCACATGTGGTTAGTGG - Intergenic
1016831770 6:148441308-148441330 CTGCTGGCACAGGCGGTTCTGGG + Intronic
1016937390 6:149457245-149457267 CAGCAGGCACAGGGGCCTCCTGG + Intronic
1017045365 6:150342244-150342266 CAGAAGGCACAGTTGGGTCAGGG + Intergenic
1018690557 6:166341062-166341084 CAGTAGGCACATGTGGTTAAAGG - Intronic
1019417674 7:934788-934810 CACCAGCCACAGATGCTTCGTGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1021807965 7:24375506-24375528 CAGGAGGCAGAGGGGGTTAGGGG - Intergenic
1023859743 7:44211277-44211299 CCTCAGGCCCAGGTGGTTGGAGG + Intronic
1026517416 7:71084915-71084937 CAGCAGCCACATGTGGCTGGTGG - Intergenic
1027459876 7:78439002-78439024 CACCAGGAACAGGTAGTTCAAGG - Intronic
1028480114 7:91295098-91295120 CAGAAGGCACATGTGGTGAGGGG + Intergenic
1028724229 7:94069437-94069459 CAGGAGGCACAGGTGGCTTTTGG + Intergenic
1033134619 7:138774099-138774121 CAGAGGGCACAGGTGGGGCGGGG - Intronic
1033165672 7:139036420-139036442 CAGCAGCCACATGTGGCTAGTGG - Intergenic
1035710139 8:1706872-1706894 GAGAAGGCAGAGGTGGTCCGTGG + Exonic
1037465011 8:19151396-19151418 CATGAGGCACAGGTGGTGTGTGG + Intergenic
1037717958 8:21415603-21415625 CAGCAGTGAGAGGTGCTTCGAGG - Intergenic
1039924421 8:41916124-41916146 CAGCTGGCACAGGTGTTTAGTGG + Intergenic
1043749012 8:83911572-83911594 GACCAGGCACAGGTTGTTTGTGG + Intergenic
1045712025 8:104995987-104996009 CAGCAGGCTCATGTGATTCAGGG - Intronic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1047429847 8:124781639-124781661 CAGCAGGAAGAGGTGGTTCTAGG - Intergenic
1047507656 8:125492607-125492629 CAGCAGCCATAGGTGGCTAGTGG + Intergenic
1049158045 8:141078827-141078849 CAGGGGGCACAGGTGGTTAGTGG + Intergenic
1049645658 8:143734501-143734523 CATGAGGCACAGGTCATTCGGGG - Intergenic
1051813845 9:21081325-21081347 CACCAGCCACATGTGGTTCATGG + Intergenic
1052849861 9:33371284-33371306 CAGCAGGAACAGGTGACTGGAGG + Intergenic
1057210396 9:93198177-93198199 CTGCAGGCTCCGGTGGTTCTGGG + Intronic
1057293078 9:93819369-93819391 CAGCAGGAACAGCTGGGTGGAGG + Intergenic
1057423015 9:94927357-94927379 CAGCAGGCACATGGGGTCTGAGG + Intronic
1057801917 9:98195963-98195985 CAGCAGGCACAGATGCTCTGGGG + Intergenic
1058532447 9:105920098-105920120 CAGTAGGCACACGTGGCTAGTGG + Intergenic
1058843503 9:108933772-108933794 CAGCAGGCAGAGGAGGCTCCGGG + Intronic
1059184147 9:112250935-112250957 CAGCAGCCATAGGGGGTTCAAGG + Exonic
1059375918 9:113881614-113881636 CAGCAGCCACATGTGGCTGGTGG + Intronic
1059440841 9:114306048-114306070 CAGCAGGCACAAGTGCTGGGAGG - Intronic
1059847214 9:118293682-118293704 CAGTAGTCACACGTGGTTAGTGG + Intergenic
1060007351 9:120012347-120012369 CAGCAGGCACAGCTGGTAGCAGG + Intergenic
1060483468 9:124031813-124031835 CAGCAGCCATACGTGGCTCGTGG + Intronic
1185469928 X:376285-376307 CTGCATCCAGAGGTGGTTCGAGG - Intronic
1188818016 X:34739303-34739325 CAGTAAGCACAGGTGATTCCAGG + Intergenic
1189281811 X:39824422-39824444 CAGTAGTCACAGGTGGCTAGTGG - Intergenic
1190826523 X:54022994-54023016 CAGCAGCCACATGTGGTTAGGGG + Intronic
1195597893 X:106713612-106713634 CAGTAGCCACAGATGGCTCGTGG - Intronic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1199509156 X:148600768-148600790 GAGCAGGCACAGGGAGTTTGGGG - Intronic
1199822220 X:151460862-151460884 CAGCAGGGAAAGGTGGTGGGTGG + Intergenic