ID: 1125744326

View in Genome Browser
Species Human (GRCh38)
Location 15:41988363-41988385
Sequence GTCTCCCGGCACTGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125744326_1125744333 -7 Left 1125744326 15:41988363-41988385 CCCTCCCCTCAGTGCCGGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1125744333 15:41988379-41988401 GGGAGACGTAAAGGTGTATAAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1125744326_1125744335 8 Left 1125744326 15:41988363-41988385 CCCTCCCCTCAGTGCCGGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1125744335 15:41988394-41988416 GTATAAGGCACAGCCCCGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 99
1125744326_1125744334 4 Left 1125744326 15:41988363-41988385 CCCTCCCCTCAGTGCCGGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1125744334 15:41988390-41988412 AGGTGTATAAGGCACAGCCCCGG 0: 1
1: 0
2: 1
3: 17
4: 173
1125744326_1125744336 9 Left 1125744326 15:41988363-41988385 CCCTCCCCTCAGTGCCGGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1125744336 15:41988395-41988417 TATAAGGCACAGCCCCGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 96
1125744326_1125744338 21 Left 1125744326 15:41988363-41988385 CCCTCCCCTCAGTGCCGGGAGAC 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1125744338 15:41988407-41988429 CCCCGGCAGGGATTTAATGCTGG 0: 1
1: 0
2: 0
3: 0
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125744326 Original CRISPR GTCTCCCGGCACTGAGGGGA GGG (reversed) Intronic
900307028 1:2015534-2015556 GCCTCCCAGCACTGAGCAGAAGG + Intergenic
903320188 1:22538501-22538523 GTTTCCCAGAGCTGAGGGGAGGG + Intergenic
904769369 1:32872315-32872337 GTCTGGGGGCACTGAGGGGATGG - Intronic
905548824 1:38819676-38819698 GTCTCCTGGCCCTGAGGTGGAGG - Intergenic
910216723 1:84850977-84850999 GGCTCCCAGCACTGGGAGGAGGG + Intronic
912178543 1:107190141-107190163 GTTTCCAGGGACTGAGAGGAGGG + Intronic
915131499 1:153698288-153698310 GTCTCCCCGGCCTGTGGGGAGGG - Intergenic
919712195 1:200739323-200739345 GTCTCCCCGCTCCGAGGGAAGGG + Intergenic
920150037 1:203898900-203898922 ATCTCCCTGCATTGAAGGGATGG + Intergenic
922704572 1:227782368-227782390 GGCTCCCAGCACTGACAGGAGGG - Intergenic
922872360 1:228913321-228913343 GTTTCCAGGGGCTGAGGGGAGGG + Intergenic
1064217420 10:13411980-13412002 GACACCAGGGACTGAGGGGAGGG - Intergenic
1065140635 10:22715017-22715039 GCTTCCCAGCACCGAGGGGAAGG + Intergenic
1067851348 10:49756703-49756725 GTGGCCAGGCACTGAAGGGAAGG - Intronic
1069740227 10:70682670-70682692 GTCTACCAGGTCTGAGGGGATGG + Intronic
1069910230 10:71754331-71754353 GGCCCCCGGGAATGAGGGGAGGG + Intronic
1070467556 10:76738831-76738853 TTCTCCAGGCACTGAGGGCAGGG + Intergenic
1071299437 10:84245297-84245319 GAGTCCGGGCACAGAGGGGAAGG - Intronic
1071483824 10:86084857-86084879 GTTTCCAGGGACTGAGGGGAGGG + Intronic
1071798633 10:89032531-89032553 GTTTCCAGGGACTGAGGAGAGGG - Intergenic
1072217771 10:93302407-93302429 GTCTCCCTGGATTGAGGTGAGGG - Intergenic
1072524448 10:96259168-96259190 GTCTCCAGGGACAGAGAGGAAGG - Intronic
1074574835 10:114658778-114658800 TTTTCCTGGTACTGAGGGGAGGG - Intronic
1075167462 10:120081983-120082005 GTGTCTAGGGACTGAGGGGAGGG - Intergenic
1075951196 10:126479181-126479203 GTCTGCAAGCACTGAGGGAAGGG + Intronic
1076558500 10:131345777-131345799 GTGGCCCGGGACTGAGGAGAAGG - Intergenic
1076695225 10:132244142-132244164 GGTGCCTGGCACTGAGGGGAGGG - Intronic
1078107243 11:8366069-8366091 TTCTCACGGCACAGTGGGGAAGG + Intergenic
1079603789 11:22341860-22341882 TTCCCCCGCCACTGAGAGGAAGG + Intronic
1080719463 11:34835315-34835337 GTTTCCAGGGACTTAGGGGAGGG + Intergenic
1083345227 11:61984870-61984892 GTTTCCAGGAGCTGAGGGGAGGG - Intergenic
1083749998 11:64755607-64755629 GAGTCCCAGCCCTGAGGGGAGGG - Intronic
1085530132 11:77187589-77187611 CTCTCCTGGCCCTGTGGGGAAGG - Intronic
1087810901 11:102608123-102608145 GTCTCTAGGCACTGAGAAGATGG + Intronic
1089298180 11:117481933-117481955 GTCCCCCAGCACTGAGGTGGGGG + Intronic
1089310327 11:117554134-117554156 GTTTCCAGGGGCTGAGGGGAGGG + Intronic
1093343664 12:18012650-18012672 GGCTCCCAGCATTGAGGCGATGG - Intergenic
1097223286 12:57462465-57462487 GTCTCCCGGGAATGAGGGTGGGG - Intronic
1102059872 12:109924075-109924097 ATCTCCTGGCTCGGAGGGGAGGG + Intronic
1104133350 12:125915625-125915647 GTCTGCCGCCACTAAGAGGAGGG + Intergenic
1105684193 13:22761900-22761922 GTTTCCTGGGCCTGAGGGGAAGG + Intergenic
1106909600 13:34449307-34449329 GTGTCCCTGCACTTATGGGAGGG + Intergenic
1113368938 13:109705367-109705389 GTCTCCCTGCTCTAAAGGGAAGG + Intergenic
1114374931 14:22134448-22134470 GTTTCCAGGGACTGGGGGGAGGG - Intergenic
1118315409 14:64722918-64722940 GTCTCCTGTCACTGAGGCAATGG - Intronic
1119740611 14:77011704-77011726 GTCTCTTGGCTCTGACGGGAAGG - Intergenic
1121207588 14:92182439-92182461 CTTTCCCTGCACTGAGGGGAAGG + Intergenic
1122442462 14:101741392-101741414 GTCTCCAGGCTTTGATGGGAGGG + Intergenic
1122779356 14:104137156-104137178 GTCTGCCGGCAGTGCGGGGTGGG + Intergenic
1122952572 14:105053678-105053700 GTCTCCTGCCACCGAGAGGAGGG - Intronic
1123985700 15:25644175-25644197 GGCTCCGGGCACTGAAGGGAGGG + Intergenic
1124620857 15:31273074-31273096 GTCTCCGGTCTCTGAAGGGAAGG + Intergenic
1125744326 15:41988363-41988385 GTCTCCCGGCACTGAGGGGAGGG - Intronic
1128235716 15:66065894-66065916 GTCTCCTGGCACAGAGGGGCTGG + Intronic
1128776103 15:70321763-70321785 GTCTCATGGCACTGAGGTGGGGG - Intergenic
1129267784 15:74403295-74403317 GTCGCCCGACATTGATGGGAGGG + Intergenic
1129748523 15:78042630-78042652 ATCTCCCAGCACCCAGGGGATGG - Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132830470 16:1925557-1925579 GTCTCCCAGCCCTGTGGGGAGGG + Intergenic
1132843898 16:1991167-1991189 GTCTCCCGGAACTGGTGGGCAGG + Intronic
1132889425 16:2196594-2196616 GGCTCCCGGCGCGGAGGGGGCGG + Intergenic
1132897010 16:2233921-2233943 GTCTCACTGCACTGAGGACATGG - Exonic
1132983898 16:2753367-2753389 GGCCCCCGGCGCTGCGGGGAGGG + Intronic
1135733867 16:24915669-24915691 GTCTCCCGGCACGGAGCTGTGGG - Intergenic
1136366028 16:29809693-29809715 GTCTCCCGGGACAGGGGGGGCGG - Exonic
1136399752 16:30010918-30010940 GTGCCCAGGCACTGGGGGGACGG + Exonic
1138521863 16:57575682-57575704 CTCTCCAGGCACTGAGGGGAAGG + Exonic
1141147180 16:81539389-81539411 GTCTGCAGGCCCTGCGGGGATGG + Intronic
1141892136 16:86933417-86933439 GTCACCCAGCACTGAGGAGGGGG + Intergenic
1141984454 16:87570912-87570934 GTCACTCGGGAGTGAGGGGAAGG - Intergenic
1142124581 16:88403838-88403860 GTGTCCTGGGACTGAGGGGAGGG - Intergenic
1143360491 17:6365247-6365269 CTCTCCCTGCACTGTGGGGGAGG - Intergenic
1143492581 17:7292945-7292967 CTCTCCCGGTGCTGAGGGGTGGG + Intronic
1143574823 17:7786112-7786134 GTCTCCCGCAGCTGAGGGAAGGG - Exonic
1144590125 17:16516701-16516723 GTATCCGGCCACTGAGGGGAAGG - Intergenic
1150567547 17:66355327-66355349 GTCTCCAGGCAAGGAGAGGAAGG - Intronic
1150640860 17:66948515-66948537 CTCTCTCGGCACTGAGGGCCTGG + Intergenic
1151550172 17:74818169-74818191 CTCTCCCTGGGCTGAGGGGACGG + Intronic
1152010118 17:77707766-77707788 CTCACCCGGCCCTGATGGGAGGG + Intergenic
1152404340 17:80087918-80087940 CTATCCCGGCACCGAGGGCAGGG - Intronic
1152529224 17:80907324-80907346 AGCTCCCAGCACTGAGGGCAGGG + Intronic
1153226768 18:2906201-2906223 GTCTCCCGGCCCTCTGGGGAAGG - Intronic
1154312340 18:13277057-13277079 GGCTCCCAACACTGATGGGAAGG + Intronic
1155162027 18:23203907-23203929 GCCTTCTGCCACTGAGGGGATGG - Intronic
1156445744 18:37235563-37235585 GTCACTCAGCACTGAGGGCAAGG + Intergenic
1156839824 18:41598292-41598314 GTTGCCAGGCGCTGAGGGGAAGG - Intergenic
1157126480 18:44960970-44960992 GCCTCCAGGCACTGAGAGGGTGG + Intronic
1159000603 18:62971567-62971589 GTCTCCGTGCATTGAGGAGATGG - Intronic
1160520829 18:79507105-79507127 GTCGCCAGGCACTGCGGGGAGGG + Intronic
1162820986 19:13223567-13223589 CCCTCCGGCCACTGAGGGGATGG - Intronic
1163700850 19:18785845-18785867 GTCTCCCACCTCTCAGGGGACGG - Exonic
1166078006 19:40425360-40425382 GACTCCCCGGACTGCGGGGAAGG - Intronic
1166532847 19:43552898-43552920 GACTCCTGGGGCTGAGGGGATGG + Exonic
1168288767 19:55347120-55347142 GTCTCCCTGCACCGATGGGGAGG + Exonic
1168315170 19:55481908-55481930 GGCTCCCGGGACTGGGGGGGCGG - Exonic
1168716256 19:58529547-58529569 GTTTCCAGGGACTGAGGAGAGGG - Intronic
925154442 2:1638968-1638990 GTCTCCCAACACTGTGGTGAGGG + Exonic
930093931 2:47552302-47552324 ATCTCCGAGCAGTGAGGGGAGGG + Intronic
934526058 2:95052456-95052478 GCCTCCAGGCAATGAGGGAAAGG + Intronic
945546706 2:211163149-211163171 GTCTCTGGGTAGTGAGGGGAAGG - Intergenic
946398185 2:219453917-219453939 GTCTGCAGGCAGTGAGGGGTGGG + Intronic
946747674 2:222861570-222861592 GCCTCCCGGCGCTGTGGGGCGGG + Intronic
1168860468 20:1042880-1042902 GTCTCCAGGCACTGTGCTGAGGG + Intergenic
1173392179 20:42645226-42645248 GTCTCCCTGAATGGAGGGGAAGG + Intronic
1173649460 20:44653720-44653742 GGCTCCCTGCTGTGAGGGGAGGG + Intergenic
1174363068 20:50040435-50040457 GTCTCTAGGCACTGGGGGCAGGG + Intergenic
1176052548 20:63127916-63127938 GTCTCCCGGGCTTGAGGGGAGGG - Intergenic
1179960765 21:44766012-44766034 GTCTCCTGGCCCCGAGTGGAAGG + Intergenic
1180010428 21:45046412-45046434 GTTTCCAGGGGCTGAGGGGAGGG + Intergenic
1180212765 21:46305151-46305173 GTTGCCAGGCACTGACGGGAGGG + Intronic
1180981450 22:19879923-19879945 GTGTCACAGCAGTGAGGGGAAGG - Intronic
1183504864 22:38203174-38203196 TTCTCATGGGACTGAGGGGATGG - Intronic
1184086767 22:42270310-42270332 GCCTCCCGGGCCTGAGGGGCAGG - Intronic
1184584485 22:45438384-45438406 GTTGCCAGGGACTGAGGGGAGGG + Intergenic
951545093 3:23816826-23816848 GTTTTCAGGGACTGAGGGGAGGG + Intronic
953240086 3:41140957-41140979 GTCTCCTGGTACTGTGGAGAAGG - Intergenic
955199014 3:56832769-56832791 GTTGTCAGGCACTGAGGGGAGGG - Intronic
957014823 3:75050877-75050899 GTTGCCAGGGACTGAGGGGAGGG + Intergenic
959529333 3:107414499-107414521 GTTTCCTGTGACTGAGGGGAGGG + Intergenic
962826893 3:139106941-139106963 CTCTCCCGGCCCTGAGGGTCAGG + Intronic
968491595 4:893211-893233 GTCTCCTATCACAGAGGGGAGGG - Intronic
968491639 4:893370-893392 GTCTCCCATCACAGAGGTGAGGG - Exonic
968555417 4:1244342-1244364 GTCTCTGGGCACTGGGGGGGGGG + Intronic
968834851 4:2955598-2955620 GCCTCCTGGCAATGAGGGGAAGG + Intronic
968897055 4:3410513-3410535 GTCTCCCAGCACTGGGCGGGAGG + Intronic
969230471 4:5826911-5826933 GGCTCCAGGGACAGAGGGGAGGG - Intronic
972303127 4:37804971-37804993 GTCTCCCTGGACTGAAGAGAGGG + Intergenic
975584928 4:75940325-75940347 GCCTCCCGGGAGTGGGGGGAAGG + Intronic
978301162 4:107270611-107270633 GTGTTCAGGCACAGAGGGGAGGG - Intronic
978747564 4:112210933-112210955 GTAGCCAGGGACTGAGGGGAGGG + Intergenic
978886970 4:113775777-113775799 CTCTCCCTGGAGTGAGGGGAGGG + Intergenic
979060422 4:116052310-116052332 GTTTCCAGGGACTGAGGGGAGGG + Intergenic
982107986 4:152027824-152027846 GTTTCCAAGGACTGAGGGGAAGG + Intergenic
985899000 5:2772180-2772202 GTCTCCTGGGACTGAGAGAAGGG + Intergenic
986321262 5:6633926-6633948 GGCACCGGGCAGTGAGGGGAGGG - Intronic
986708088 5:10467963-10467985 GTGGCCCAGCACTCAGGGGACGG - Intronic
986777317 5:11028534-11028556 GTTTCCAGGGACTGAAGGGAAGG - Intronic
988064816 5:26219786-26219808 GTCTCCTGTCTCTGAGGAGAAGG + Intergenic
990305790 5:54493013-54493035 TTCTACCAGCACTCAGGGGAAGG - Intergenic
991939938 5:71840926-71840948 GTTGCCAGGAACTGAGGGGAGGG - Intergenic
993353743 5:86881102-86881124 GCCTTCTGGCACTTAGGGGATGG + Intergenic
993694800 5:91048508-91048530 GTCCCCTGGAGCTGAGGGGAAGG - Intronic
995402159 5:111755804-111755826 GTCTCCCTGGACTGAAGAGAGGG - Intronic
997199167 5:131999424-131999446 GGCTCCTGGCACTGAGGAGGCGG + Intronic
997975572 5:138439716-138439738 GTCTCCTGACAGTGAGTGGAAGG - Intronic
999022116 5:148178050-148178072 GTTTCCAGGGACTGGGGGGAGGG - Intergenic
999244946 5:150149136-150149158 AACTCCAGGCACTGTGGGGAGGG + Intronic
1000381264 5:160631725-160631747 GTATCCCGTCACTGAGGTGGAGG - Intronic
1001696713 5:173675689-173675711 GGCTCCTGGGACAGAGGGGAAGG - Intergenic
1001934243 5:175693321-175693343 GTCTCCAGGCAGGGTGGGGAGGG - Intergenic
1002057928 5:176609618-176609640 GCTTCCCGCCACTGGGGGGAGGG - Intronic
1006898800 6:37486892-37486914 GTCTCAGGGTACTGAGGGGCTGG - Intronic
1006984708 6:38168891-38168913 TTCTCCAGGCACTGGGGGGTGGG + Exonic
1007756149 6:44101042-44101064 GTCTACTGGGAGTGAGGGGAAGG - Intergenic
1010059290 6:71604094-71604116 GTCTTCCTGCGCTGAGGAGACGG - Intergenic
1012612395 6:101231658-101231680 GTCTCCTGTCACTGAAGAGAAGG - Intergenic
1015489926 6:133813387-133813409 TTCTCCTGGCACTTAGTGGATGG + Intergenic
1018165563 6:161090917-161090939 GTCTCCAGACGCTGAGGGGAGGG + Intronic
1019499659 7:1358614-1358636 GTCTCCCGGGCCTGGGGGGACGG - Intergenic
1021573886 7:22090525-22090547 GGCCCCAGGCAGTGAGGGGAAGG + Intergenic
1021718207 7:23480700-23480722 GTCTCCCTGGACTGAAGAGAGGG + Intergenic
1022059252 7:26774590-26774612 GTCACCTGGAACTGAGGGGTTGG - Intronic
1022474131 7:30699400-30699422 GATTCCAGGCACTGAGAGGAAGG + Intronic
1022537088 7:31105023-31105045 GGCTCCCAGCACTGAGAGGAGGG + Intronic
1023873782 7:44276192-44276214 GTCTCCAGGCTGGGAGGGGAGGG + Intronic
1024041109 7:45555554-45555576 GTTTCCAGGGACTGAGGGGAGGG + Intergenic
1027187235 7:75979810-75979832 GGCAGCCGGCACTCAGGGGAGGG - Intronic
1027680230 7:81211211-81211233 GTCTCCCTGAAATGAGGAGAAGG - Intergenic
1027715630 7:81665791-81665813 TATTCCCGGCACTGAGGGTATGG + Intergenic
1029491643 7:100873963-100873985 TGCTCCCAGCACTGAGAGGAGGG - Intergenic
1032409458 7:131683832-131683854 GTCTCCAGGCACTGAGCAGCTGG - Intergenic
1034924398 7:155109736-155109758 GTCTGCTGGGACTTAGGGGAGGG + Intergenic
1039105377 8:33983982-33984004 GTCTCCCATCAGTGAGGGGAAGG + Intergenic
1039667948 8:39556853-39556875 GTTTCCAGGGTCTGAGGGGAAGG - Intergenic
1048373870 8:133804762-133804784 GTATCCTGGCACTGAAGGCAGGG - Intergenic
1048689009 8:136937645-136937667 TTCCACCTGCACTGAGGGGATGG + Intergenic
1049584708 8:143427554-143427576 CTCTTCCGGCAGTGAAGGGAGGG + Intronic
1049706670 8:144046285-144046307 GCCTCCAGGGACTGAGGGCAGGG - Intronic
1053175200 9:35917562-35917584 GTCTCCCTCCACTGCTGGGATGG - Intergenic
1053399029 9:37801137-37801159 GGCCGCCGGCACGGAGGGGAGGG - Exonic
1055182710 9:73407800-73407822 GTTGCCAGGGACTGAGGGGAGGG + Intergenic
1059226408 9:112677070-112677092 GTGGCCAGGCACTGAGGGAAGGG - Intergenic
1061202837 9:129147375-129147397 TTCTCCAGGCACTGTGAGGAAGG - Exonic
1061373131 9:130209058-130209080 GTCTCCAGGGAGTGTGGGGAGGG + Intronic
1185505634 X:630829-630851 GTCTCCCCGCGCGGAGAGGACGG - Exonic
1198956523 X:142137161-142137183 GCCTCCTGGAACTGAGGGAAAGG - Intergenic
1199548990 X:149037772-149037794 GTTTCCAGGCATTGTGGGGAGGG + Intergenic
1201437476 Y:13975122-13975144 GTCTCCCAGCATTGAGCAGAAGG + Intergenic
1201717308 Y:17059962-17059984 ATCACCTGGCACTGAGAGGAAGG + Intergenic