ID: 1125745836

View in Genome Browser
Species Human (GRCh38)
Location 15:41996632-41996654
Sequence CGTGGGAAGAAGGGGCGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125745828_1125745836 -9 Left 1125745828 15:41996618-41996640 CCACCGTCTGCTCCCGTGGGAAG 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1125745836 15:41996632-41996654 CGTGGGAAGAAGGGGCGGTCTGG 0: 1
1: 0
2: 1
3: 33
4: 191
1125745827_1125745836 -8 Left 1125745827 15:41996617-41996639 CCCACCGTCTGCTCCCGTGGGAA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1125745836 15:41996632-41996654 CGTGGGAAGAAGGGGCGGTCTGG 0: 1
1: 0
2: 1
3: 33
4: 191
1125745821_1125745836 28 Left 1125745821 15:41996581-41996603 CCACACAAGGGAGGCAACAGAGG 0: 1
1: 0
2: 2
3: 35
4: 250
Right 1125745836 15:41996632-41996654 CGTGGGAAGAAGGGGCGGTCTGG 0: 1
1: 0
2: 1
3: 33
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125745836 Original CRISPR CGTGGGAAGAAGGGGCGGTC TGG Intronic
900562057 1:3312111-3312133 CGTGGGAAGGTGGGGGAGTCAGG - Intronic
901102503 1:6729837-6729859 CGTGGGCAGGAGGGGCTCTCCGG + Intergenic
903338977 1:22642637-22642659 CTAGGGATGAAGGGGCTGTCAGG - Intergenic
906430246 1:45750382-45750404 CGGGGGAGGCAGGAGCGGTCCGG + Intronic
909576704 1:77184378-77184400 CCTGGGATGAAGGGGAGGTCAGG + Intronic
911137549 1:94457546-94457568 CGGGGAAAGAGGGGGCTGTCAGG - Intronic
915904009 1:159865074-159865096 AGTGGGGAGGAGGGGTGGTCTGG + Intronic
919654029 1:200180331-200180353 TGTGGGAAGAAGGAGAGGTGAGG - Intergenic
1062846734 10:713072-713094 AGTGGGAAGAGGGGAGGGTCTGG - Intergenic
1065487703 10:26250500-26250522 TGAGGGAAGAAGGAGGGGTCGGG + Intronic
1066391257 10:34978967-34978989 AGTGGGAAGGAGGGGAGGGCTGG - Intergenic
1068866620 10:61901942-61901964 GGTGGGTAGAAGTGGCGGTGGGG + Intronic
1070814975 10:79317285-79317307 AGAGGGAAGAAGGGCCGGGCCGG + Intergenic
1072508013 10:96089861-96089883 CCTGGGAGGAAGGGGCGGGCCGG - Intergenic
1072934295 10:99697467-99697489 CATGGGAAGAAGATGCAGTCTGG - Intronic
1073453735 10:103624188-103624210 CCTGGGAAGAAGGGGATGTGGGG + Intronic
1074704410 10:116118456-116118478 GGTGGGAAGAAGGGGCCTTGGGG - Intronic
1075364086 10:121867493-121867515 CTTGGGAAAAAGGGGCTGGCAGG - Intronic
1076050439 10:127329256-127329278 CAGGGGAAGCAGGGGAGGTCAGG - Intronic
1076882729 10:133247523-133247545 CATGGGAAAACGGGGCGGTCGGG - Intergenic
1077311405 11:1890495-1890517 CTTGGGCAGCAGGGGCGGTGGGG + Exonic
1079093585 11:17496914-17496936 CGTGGGAAGAAGGTGCAGCCTGG - Intronic
1081713824 11:45234530-45234552 AGTGGGAAGAAGGCTCGGCCCGG - Intronic
1081793643 11:45805332-45805354 TGTGGGAGGGAGGGGCGGGCAGG - Exonic
1083224120 11:61273920-61273942 CGAGGGAAGAAGGGTGGGGCAGG - Intronic
1083720056 11:64599593-64599615 GGTGGGAACAATGGGCGGTGGGG - Intronic
1085339137 11:75719965-75719987 GGAGGGAAGAAGGAGCTGTCAGG - Intronic
1088664879 11:112084737-112084759 CTTGGGAGGAAGGGAAGGTCAGG - Exonic
1089472458 11:118731850-118731872 CAGGGGAAAAAGTGGCGGTCAGG - Intergenic
1089683302 11:120131488-120131510 TGTGGGCAGAAGAGTCGGTCAGG + Intronic
1089814785 11:121162603-121162625 CGTGGGAAGATGGGGCTCTCTGG + Intronic
1090246016 11:125216506-125216528 CGAGGGGAGAAGGGGCAGGCTGG - Intronic
1091110282 11:132960293-132960315 CGTGGTAAGAAGGGAAGGACTGG - Intronic
1091225910 11:133956479-133956501 CGTGGGCTGGAGGGGCGGGCGGG - Intronic
1091621919 12:2095491-2095513 AGGGAGAAGAAGGGGAGGTCAGG - Intronic
1092999265 12:13980360-13980382 AGGGGGAAAAAGAGGCGGTCAGG + Intergenic
1094843101 12:34350120-34350142 CATGCGCAGAAGGGGCGGTGTGG + Intergenic
1095668838 12:44834961-44834983 GGTGGGAAGAAGGGCAGGGCTGG + Intronic
1096781399 12:53994324-53994346 CGTGGCCAGAAGGGGTGTTCGGG + Intronic
1101253322 12:102955846-102955868 CATGGGGAGAAGGGGCTGTGTGG + Intronic
1102501786 12:113358421-113358443 CGTAGGTGGAAGGGGCGGCCGGG + Intronic
1103239000 12:119397978-119398000 AGTGGGAGGAAGGGGCGGTGTGG + Intronic
1103331241 12:120155487-120155509 AGTGGGAAGAAGGGCTGGGCTGG - Intronic
1103418958 12:120764736-120764758 CGTGGGAGGAAGGCGCGCTGGGG + Exonic
1104844155 12:131838488-131838510 CGTGGGAGGAGGGGGCGGCTCGG + Intronic
1105041752 12:132966693-132966715 CGTGGGAAGGAGGGGCGGGGTGG - Intergenic
1105512186 13:21060793-21060815 CGTGGGACGATGGCGCGGCCGGG + Intronic
1114651087 14:24284928-24284950 CATGAGTAGAAGGGGAGGTCAGG - Intergenic
1123098988 14:105783023-105783045 CTGGGGAAGAAGGGGTGTTCTGG + Intergenic
1202905775 14_GL000194v1_random:71809-71831 CTTGGGTAGAAGTGGGGGTCGGG - Intergenic
1124965343 15:34429162-34429184 CATGGGAGGAAGACGCGGTCAGG - Intronic
1124981961 15:34575364-34575386 CATGGGAGGAAGACGCGGTCAGG - Intronic
1125609301 15:40959961-40959983 AGTGGGTAGAAGGGGCATTCCGG + Intergenic
1125745836 15:41996632-41996654 CGTGGGAAGAAGGGGCGGTCTGG + Intronic
1125937509 15:43649301-43649323 CGGGGGAAGAAGGGCCGGGCTGG + Intronic
1127224926 15:56918734-56918756 CCCGGGAGGAAGGGGCGGCCAGG + Exonic
1127870399 15:63068181-63068203 CGTGGGAAGCAGTGGGGGTGTGG + Intronic
1129803872 15:78438277-78438299 CGGGGGAAGAAGGGGGAGGCCGG - Exonic
1130884974 15:88085139-88085161 CGTAGGAAGAAAGGTGGGTCAGG - Intronic
1131071983 15:89471722-89471744 CCTGGGATGAAGGGGAGGGCAGG + Exonic
1132237652 15:100234114-100234136 CGTGGGAGGAATGGCCGGTGTGG + Intronic
1134625275 16:15718683-15718705 TGTGGGGAGAAGGGGAGGCCAGG - Intronic
1136069075 16:27777492-27777514 CTCGGGAAGACGGGGCTGTCAGG - Intronic
1137787892 16:51152355-51152377 CGTGGGATAAGGGGGCGGCCCGG + Intergenic
1142155684 16:88531973-88531995 GGTGGGAAGCAGGCGGGGTCAGG - Intronic
1142271517 16:89092174-89092196 GGTGGGAAGCAGGAGCAGTCAGG - Intronic
1142883209 17:2896849-2896871 CGTGGGCACAAGGGGAGGCCCGG - Intronic
1143362809 17:6385534-6385556 TCTGGGAAGAAGGGGCTGCCAGG - Intergenic
1143483198 17:7238750-7238772 TGTGGGGAGAAGAGGGGGTCTGG - Intronic
1143638544 17:8181519-8181541 AGTGGGAAAAAGGGAGGGTCAGG + Intergenic
1145996785 17:29109560-29109582 CGTGGGAAGAAAGGGAGCTGTGG + Intronic
1146943609 17:36859966-36859988 GGTGGGAAGAAGGGGAGGCCTGG + Intergenic
1147419732 17:40316599-40316621 CGTGGGCACTAGGGGCGGGCTGG + Intronic
1147440308 17:40443587-40443609 CGCGGGGAGACGGGGCGGCCCGG - Exonic
1149227554 17:54492127-54492149 CAAGGGAAGAAGGGGCATTCTGG + Intergenic
1151509314 17:74548608-74548630 CCTGGAATGAAGGGGAGGTCAGG + Intergenic
1151740557 17:75979213-75979235 CGGAGAAAGAAGGGGCGGGCCGG - Exonic
1152512158 17:80797827-80797849 CGTGGGAAAAAGGGGCCCTGAGG - Intronic
1152720008 17:81918776-81918798 GGTGGGAAGAAGGGCAGGGCTGG + Exonic
1153225141 18:2894177-2894199 CGTGGGAAGCAGGCGAGCTCTGG + Intronic
1153261169 18:3225771-3225793 AGGGGGAAGAAGGGGCGTGCTGG - Intergenic
1154383053 18:13869823-13869845 CCTGGGAAGAAGTGGTGGTGAGG - Intergenic
1157098909 18:44711968-44711990 CCAGGGAAGAAGGGGCAGGCAGG - Intronic
1157395778 18:47339754-47339776 TGTGGGAAGATGGGTAGGTCAGG + Intergenic
1158538392 18:58329155-58329177 CATGGGAAGAAGGAGCTGCCGGG - Intronic
1160370490 18:78368761-78368783 CGTGGGAGGAAGTGGCGGGATGG + Intergenic
1161440976 19:4291508-4291530 GGGGAGAAGAAGGGGAGGTCAGG - Intergenic
1161801151 19:6417364-6417386 CGTGGGGAGAAGGGCCCCTCTGG - Intronic
1162740878 19:12772912-12772934 CCTGGGGAGAAGGGGGTGTCAGG + Exonic
1162806626 19:13140633-13140655 GGTGGGGAGAAGGGTCGGGCAGG + Exonic
1165830608 19:38728580-38728602 CTAGGGAAGAAGGGGGGCTCGGG - Intronic
1166007530 19:39917678-39917700 CCTGGGGAGCAGGGGTGGTCAGG - Intronic
1166211159 19:41307419-41307441 AGAGGGAAGAAGGGGAGGTTGGG + Intronic
1167441843 19:49513328-49513350 CCCGGGAGGAAGGGGCGGGCCGG + Intronic
925327548 2:3035292-3035314 TGTAGGAAGAAGGGGTGGCCTGG - Intergenic
926175590 2:10588896-10588918 CGAGGGAAGCAGGGGAGGTAAGG - Intronic
929312101 2:40437275-40437297 GGTGGGAAGAAGGGGCAGCATGG - Intronic
934500828 2:94858694-94858716 CTTGGGTAGAAGTGGGGGTCGGG + Intergenic
935815260 2:106841583-106841605 CCTGGGAAGAAGGGGGGTTCCGG + Intronic
938900877 2:135797612-135797634 CTTGACAAGAAGGGGCGGGCGGG + Intronic
942045100 2:172095405-172095427 CGAGGGAAGAAAGGTCTGTCTGG + Intergenic
944282324 2:197912108-197912130 GCTGGGAAGAAGGTGCTGTCTGG + Intronic
945384702 2:209183256-209183278 GGTGGGGAGAAGGGGCAGTTGGG - Intergenic
945608193 2:211963273-211963295 GGTGGGAAGAAAGGGCTGTCTGG - Intronic
946702035 2:222424254-222424276 CGGGGGAAGAAGGTGGGGTGGGG + Intergenic
947549458 2:231036296-231036318 AGTGGGAAGAAGAGGCTGCCGGG + Intergenic
947792497 2:232876185-232876207 CGCGGGGAGAAGGGCCGGCCAGG + Intronic
1172799750 20:37567541-37567563 CGTAGGAGGAAGGGGAGGTGGGG - Intergenic
1173859819 20:46275955-46275977 GGTGGGAAGAAGAGGGGTTCAGG + Intronic
1175120082 20:56710588-56710610 AGGGGGAAGAAGGAGCGGTAGGG - Intergenic
1176625132 21:9086566-9086588 CTTGGGTAGAAGTGGGGGTCGGG - Intergenic
1178356104 21:31911824-31911846 CATGGGGAGAAGGGGTGGTGGGG - Intronic
1179997431 21:44980468-44980490 CCTGAGAAGAAGGGGAGGGCCGG - Intergenic
1180723433 22:17926672-17926694 AGTGGGAAGTAGGAGCGGTGTGG - Intronic
1180824619 22:18854032-18854054 CGTGGGCCGGAAGGGCGGTCAGG + Intronic
1181125043 22:20697188-20697210 CGTGGGCCGGAAGGGCGGTCAGG + Intergenic
1181188114 22:21120515-21120537 CGTGGGCCGGAAGGGCGGTCAGG - Intergenic
1181211084 22:21289978-21290000 CGTGGGCCGGAAGGGCGGTCAGG + Intergenic
1181398417 22:22636910-22636932 CGTGGGCCGGAAGGGCGGTCAGG - Intergenic
1181449074 22:23005123-23005145 AATGGGAAGAGTGGGCGGTCTGG + Intergenic
1181501156 22:23316268-23316290 CGTGGGCCGGAAGGGCGGTCAGG - Exonic
1181650997 22:24259150-24259172 CGTGGGCCGGAAGGGCGGTCAGG + Intergenic
1181706384 22:24651589-24651611 CGTGGGCCGGAAGGGCGGTCAGG - Intergenic
1181801475 22:25350620-25350642 CCTGGGAGGAGGGGGCGGTGTGG - Intergenic
1183417174 22:37689094-37689116 CCTGGGAAGAAGGGGCGTGGGGG + Intronic
1183951654 22:41356066-41356088 AGTGGGCAGACGGGGCGGGCGGG + Intronic
1184510098 22:44928389-44928411 CATGGGAAGAAGGGGTGCTGTGG - Intronic
1203215863 22_KI270731v1_random:5453-5475 CGTGGGCCGGAAGGGCGGTCAGG - Intergenic
1203274762 22_KI270734v1_random:79938-79960 CGTGGGCCGGAAGGGCGGTCAGG + Intergenic
950388094 3:12675558-12675580 CGTGGGAAGAAGAGGCATTCTGG - Intergenic
950591286 3:13937201-13937223 CAAGGGCAGAAAGGGCGGTCAGG - Intergenic
953770861 3:45777825-45777847 CCTGGGAAGCAGGCCCGGTCTGG - Intronic
954677638 3:52324555-52324577 GGTGGGGAGGAGGGGCGGACAGG - Intronic
961648863 3:128407591-128407613 TGTGGGAAGAGAGGGCAGTCAGG - Intronic
962235066 3:133700470-133700492 CGTGGGGAGAAGAGGAGCTCAGG + Intergenic
964139329 3:153378968-153378990 GGTGGGGAGGAGGGTCGGTCGGG + Intergenic
968284913 3:197502854-197502876 CCTGGGAAGAAAGGGCTGTTAGG - Intergenic
968494290 4:906909-906931 GGTGAGCAGAAGGGGCGGTCTGG - Intronic
968693278 4:2008101-2008123 CGCGTGAGGAAGGGGCGGCCTGG - Intronic
968965673 4:3768037-3768059 GCTGGGCAGAAGGGGCGGCCCGG + Exonic
968984105 4:3866058-3866080 CGTGGGCAGGAGGGGCAATCTGG + Intergenic
969132803 4:5004154-5004176 GGAGGGAAGAATGGGGGGTCAGG + Intergenic
972245808 4:37244678-37244700 CGTGGGAGGAGGGGGCCGCCAGG - Exonic
973613710 4:52659386-52659408 CGCGGGGAGGAGGGGCGGCCCGG + Intergenic
980277563 4:130674482-130674504 TGTGGGAACAAGGGGCATTCAGG + Intergenic
985508416 5:298441-298463 AGTGGGAAGAAGGAGGGGACGGG + Intronic
985610704 5:886416-886438 GGTGGGCAGGAGGGGCTGTCTGG + Intronic
985739630 5:1607227-1607249 AGTGGGAAGAAGGAGGGGACGGG - Intergenic
986296672 5:6445110-6445132 GGTGGGCAGAAGGGGCTGTGTGG - Intergenic
986374768 5:7119179-7119201 ACTGGGAAGAATGGGAGGTCTGG - Intergenic
987152354 5:15055978-15056000 CTGGGGAAGAAGGGGTGCTCTGG + Intergenic
992420320 5:76597360-76597382 CTTGGGAAGAAGGGCTGGTTGGG + Intronic
993904926 5:93612147-93612169 CGTGGGACCAAGGGCCGGACGGG + Intergenic
998026239 5:138819069-138819091 ATTGGGAAGAAGGGGTGCTCTGG + Intronic
999218746 5:149957914-149957936 CCTGGGAAGAATGGGTGGTCAGG + Intergenic
1001608893 5:172983984-172984006 CTTGGGAGGAACGGGCGGTGAGG + Intronic
1002176420 5:177403739-177403761 CGTGGAAAGAAGGGTGGGGCGGG + Intronic
1002616937 5:180461783-180461805 CCTGGGAAGAAGCTGCTGTCAGG - Intergenic
1002632494 5:180590950-180590972 CGCAGGAGGGAGGGGCGGTCGGG - Intronic
1003139272 6:3457133-3457155 CGGGGGGAGAGGGGGCGGGCCGG - Intergenic
1003838423 6:10095181-10095203 AGAGGGAGGAAGGGGCGGTTAGG + Intronic
1005624508 6:27650729-27650751 CGCGGGAAGATGGGGCGATGTGG + Intergenic
1008109690 6:47478380-47478402 CAGGGCAAGAAGGGGCGGTGGGG - Intronic
1008673105 6:53793866-53793888 TGTGGAACGAAGGGGCGGCCGGG + Intergenic
1012158905 6:95857502-95857524 GGTGGGAAGAAGGGGTGATGAGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1016993118 6:149942977-149942999 CGTAGGAAGAACAGGCGGTCTGG - Intronic
1017005218 6:150024547-150024569 CGTAGGAAGAACAGGCGGTCTGG + Intronic
1018799323 6:167210279-167210301 CGTGGGCAGAAGGGGCTGGAAGG - Intergenic
1019217842 6:170455037-170455059 CGGGGGGAGAAGGGGCAGCCTGG + Intergenic
1019570935 7:1711837-1711859 CTTGGGAAGACAGGGCAGTCTGG + Intronic
1019746488 7:2703041-2703063 GGTGGGAAGAAGGAGCTCTCCGG - Intronic
1022053563 7:26704718-26704740 AGGGGGAAGAAGGGGAGGTTAGG + Intronic
1023068765 7:36406278-36406300 AGTTGGCAGAAGGGGCCGTCTGG + Exonic
1023487144 7:40699375-40699397 CGTGAGAAGAAAGGGAGCTCAGG + Intronic
1023882438 7:44327996-44328018 GGTGGGAAGAGGGGGAAGTCTGG - Intronic
1029507529 7:100971388-100971410 GGTGGGCAGAAGGGGTGGTGAGG + Intronic
1034105637 7:148487175-148487197 GGTGGGAAGAGGAGGCGGTCAGG + Intergenic
1036610404 8:10345015-10345037 GTTGGGAAGATGGGGCTGTCTGG + Intronic
1037686685 8:21145749-21145771 CATGGGAATAAGTGGCTGTCAGG + Intergenic
1037788850 8:21919500-21919522 GGTGGGAGGAAGGAGCGGGCCGG - Intergenic
1038906390 8:31908447-31908469 TGTGGGTAGAAGGGGCCTTCGGG + Intronic
1041281114 8:56211647-56211669 CCTGGGCCGCAGGGGCGGTCGGG - Intergenic
1048214167 8:132480575-132480597 TCTGGGAAGAAGGGGCGCTCGGG + Exonic
1049264566 8:141660525-141660547 CCTGGGAAGAAGTGGTGCTCAGG + Intergenic
1049365890 8:142236688-142236710 GGTGGGAAGAGGTGGTGGTCTGG - Intronic
1051173678 9:14343814-14343836 CTTGGGGACAAGGGGGGGTCGGG + Intronic
1051359968 9:16273365-16273387 CTTGGGAAGAAGGTGCAGACAGG - Intronic
1053656352 9:40221848-40221870 CTTGGGTAGAAGTGGGGGTCGGG - Intergenic
1053906700 9:42851066-42851088 CTTGGGTAGAAGTGGGGGTCGGG - Intergenic
1054528264 9:66154437-66154459 CTTGGGTAGAAGTGGGGGTCGGG + Intergenic
1054676081 9:67857822-67857844 CTTGGGTAGAAGTGGGGGTCGGG - Intergenic
1057075023 9:92134145-92134167 CGTGGGAAGGCGGGGCAGACTGG + Intergenic
1057092259 9:92268970-92268992 CAAGAGAAGAAGGGGAGGTCTGG - Intronic
1057401517 9:94727175-94727197 CGGGGGAAGAAGAGGCGGATGGG - Intronic
1057560927 9:96127198-96127220 GTTGGGAAGGAGGGGCGGGCAGG + Intergenic
1057720394 9:97527643-97527665 CGGGGGAAGAGGGGGCGGCAAGG + Intronic
1062076662 9:134593444-134593466 CATGGCAAGAAGGGGCGGCCAGG - Intergenic
1062340983 9:136093977-136093999 GGTGAGAAGAAGGGGCGACCTGG + Intronic
1062452381 9:136621064-136621086 TGTGGGAAGAGGGGGCTTTCTGG - Intergenic
1062501707 9:136854625-136854647 CGTGGCCAGGAGGGGCGCTCAGG - Exonic
1062702813 9:137916911-137916933 GGTGGGAAGAATGGGAGGTTAGG + Intronic
1203748305 Un_GL000218v1:57026-57048 CTTGGGTAGAAGTGGGGGTCGGG - Intergenic
1203561417 Un_KI270744v1:60981-61003 CTTGGGTAGAAGTGGGGGTCGGG + Intergenic
1185432139 X:17534-17556 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185432221 X:17726-17748 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185432303 X:17918-17940 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185432397 X:18142-18164 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185432479 X:18334-18356 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185432604 X:18621-18643 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185441510 X:230379-230401 CGTGGGTAGAAGGGGGGGTCTGG - Intergenic
1185441606 X:230604-230626 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185441672 X:230765-230787 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185441699 X:230831-230853 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185441767 X:230992-231014 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185441794 X:231058-231080 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185441876 X:231250-231272 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1185441958 X:231442-231464 CGTGGGTAGGAGGGGGGGTCTGG - Intergenic
1186438878 X:9567631-9567653 CGAGGGAAGAAGGGGCCACCTGG - Intronic
1189280636 X:39818273-39818295 CGTGTGAAAAGAGGGCGGTCTGG + Intergenic
1189327648 X:40122631-40122653 CATGGGAAGAAGGAGCCGACTGG - Intronic
1192432157 X:71119638-71119660 GGTGGGAAGAAGGGGCAGACAGG - Intronic
1193079273 X:77390085-77390107 CCTGGGAAGAACAGGGGGTCAGG + Intergenic
1195398317 X:104435032-104435054 CGTGGGCAGAAGGGGCAGGGAGG + Intergenic
1200231680 X:154446916-154446938 TGTGAGAACAAGGGGCTGTCAGG + Intronic
1201161654 Y:11171996-11172018 CTTGGGTAGAAGTGGGGGTCAGG - Intergenic