ID: 1125746050

View in Genome Browser
Species Human (GRCh38)
Location 15:41997923-41997945
Sequence CAGGAGCCTGGACTTGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125746050 Original CRISPR CAGGAGCCTGGACTTGTTTG GGG (reversed) Intronic
902082234 1:13829039-13829061 CTGGAGCCTGGACTTGAGGGAGG - Intergenic
902276587 1:15344294-15344316 CATGAATCTTGACTTGTTTGAGG + Intronic
902505557 1:16937489-16937511 GAGGAGCCGGGACTTGTCTGAGG + Intronic
903687059 1:25139507-25139529 CAGGAGCCTGTGCCTTTTTGCGG - Intergenic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
906181982 1:43829528-43829550 AAGGAGCCTGGACTTGCTGATGG - Intronic
907444780 1:54500440-54500462 CCAGAGCCTGGACTTGCTGGTGG + Intergenic
908243617 1:62209600-62209622 AGGGAGACTTGACTTGTTTGGGG + Intronic
912797366 1:112701193-112701215 CAGGCCCCTGGAGTTGTTTTCGG - Exonic
916106360 1:161435500-161435522 CAGCAGCCTGGACCTGTTGCAGG + Intergenic
917804415 1:178600334-178600356 CAGGAGACTGGACGTGGGTGAGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918519268 1:185397389-185397411 CAGTAGCCTGGATTTGTCTCAGG + Intergenic
919381515 1:196867106-196867128 CAGCTGCCTGGGCTTGTCTGTGG - Intronic
920057538 1:203203433-203203455 CAAGAGCTTGGACATGCTTGTGG + Intergenic
920162683 1:204011420-204011442 CAGACACCTGTACTTGTTTGTGG - Intergenic
923857641 1:237862330-237862352 CATGAGCCTGGACCTGCTAGGGG - Intergenic
1074456978 10:113603716-113603738 GAGCAGCCTTGACCTGTTTGAGG - Intronic
1076851472 10:133095518-133095540 GAGGAGCCTGGACCTGTGCGAGG - Intronic
1077052409 11:573232-573254 CAGGAGCCTCGGCGTGTCTGTGG + Intergenic
1078328431 11:10398828-10398850 CAGGAGACTGGACTTCCTGGGGG + Intronic
1079122855 11:17697393-17697415 CAGGTGCCTGGACAGGCTTGGGG + Intergenic
1081853539 11:46290223-46290245 CAGGAGCCAGGACATGGTTCAGG - Intronic
1084398688 11:68931339-68931361 CAGGAGCCTGGCCTCTTCTGAGG - Intronic
1086696816 11:89857053-89857075 CAGCAACATGGACTTTTTTGTGG - Intergenic
1086709342 11:89987435-89987457 CAGCAACATGGACTTTTTTGTGG + Intergenic
1087144735 11:94800172-94800194 CAGGAGCACGGACTTTTTTATGG + Exonic
1087401977 11:97678876-97678898 CAGGTGTGTGGACTTGTTTTGGG + Intergenic
1089103994 11:115987013-115987035 CAGGAGCCTGGGAGTGCTTGGGG - Intergenic
1090784475 11:130037180-130037202 CAGTTGCCTGGACTTGTTAGCGG + Intergenic
1096476431 12:51912008-51912030 CAGGAGCCTGTTTATGTTTGAGG + Intronic
1100117882 12:91330563-91330585 TACCAGCCTGGACTTGTTTCTGG - Intergenic
1104216703 12:126740913-126740935 CAGGAGGCTGGACATTTTGGGGG + Intergenic
1105431303 13:20339919-20339941 TAGGAGCCTGGGCTTGGTGGCGG + Intergenic
1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG + Intronic
1106901980 13:34363317-34363339 CAGGAGCCTGGCGTTTTGTGTGG - Intergenic
1108552231 13:51557996-51558018 GGGGAGCCTGGACTCGTGTGTGG - Intergenic
1109132478 13:58604684-58604706 CAGGAGCCTAGAATTGTTAGGGG + Intergenic
1111866456 13:93774783-93774805 AAGGGGCCTGTACTTGATTGGGG + Intronic
1113353298 13:109550939-109550961 CAGGTTCTTTGACTTGTTTGAGG - Intergenic
1113766609 13:112885504-112885526 TAGGAGCCTGTGCGTGTTTGGGG - Exonic
1114081053 14:19201571-19201593 CAGGACCCTGGACCTGTGTGGGG - Intergenic
1114205843 14:20570572-20570594 CAGCAGCCTGGACATGTTGCAGG - Intergenic
1115836161 14:37406612-37406634 AAGGAGAGTGGACTTTTTTGAGG + Intronic
1119272008 14:73314580-73314602 CAGGAGCCTGGAGTGGGTTAAGG - Intronic
1121771853 14:96552518-96552540 CAGCAGCCTCGACTTGTCTATGG + Exonic
1122400138 14:101462119-101462141 CAGGAGCCAGGACCTGCTGGAGG - Intergenic
1122720428 14:103718881-103718903 CACGAGCCTGGACTCGGATGAGG + Intronic
1122937610 14:104967237-104967259 CAGGAGCCTGGATGGGTTGGGGG + Intronic
1124994434 15:34709198-34709220 AAGCAGCCTGGACTTGGATGTGG - Intergenic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1125765874 15:42135850-42135872 CAGGATGCTTGTCTTGTTTGGGG + Intergenic
1127760142 15:62131667-62131689 CAGAAGCCTGGACTCACTTGTGG + Intergenic
1128771802 15:70288430-70288452 CAGGAGCCCGGAGGTGTCTGGGG - Intergenic
1128777881 15:70337547-70337569 CAGGACCCTGGGATGGTTTGGGG - Intergenic
1130283539 15:82537507-82537529 TACCAGCCTGAACTTGTTTGAGG - Intronic
1131152324 15:90054761-90054783 CAGGATAGTGTACTTGTTTGGGG + Intronic
1131378648 15:91946067-91946089 CATGATCCTGCACTAGTTTGTGG + Intronic
1131470020 15:92688724-92688746 CAGGAGAATGGAATGGTTTGAGG + Intronic
1132077988 15:98838944-98838966 CAGGAGCCTGGGGTTGAGTGGGG - Intronic
1132335215 15:101044078-101044100 CAGGAGCGGGGACTTGCCTGGGG - Intronic
1133257871 16:4529093-4529115 CAGAGGCCTGGACTGGTTAGTGG + Intronic
1134064514 16:11219150-11219172 CAGCAGCAGGGACTTCTTTGTGG - Intergenic
1135379817 16:21986296-21986318 CAGGTGCTTGGTATTGTTTGTGG + Intronic
1135598353 16:23760650-23760672 CAGGAACCTGGAATTGTCCGGGG + Intergenic
1136282165 16:29220338-29220360 CAGGATCCTGGACTTGTCATGGG + Intergenic
1138425716 16:56931101-56931123 GAGGAGCCTGGTCTGGTTGGTGG - Intergenic
1139596887 16:67963464-67963486 CAGGAACCTGGCACTGTTTGAGG - Intronic
1141807905 16:86354127-86354149 CAGCAGCCTGGTGTGGTTTGGGG + Intergenic
1141920461 16:87132357-87132379 CAGGAGCCTGCACCTGTTCCTGG - Intronic
1142086536 16:88186257-88186279 CAGGATCCTGGACTTGTCATGGG + Intergenic
1142702916 17:1675115-1675137 CAGTAGCATGGAATTGTGTGTGG - Intronic
1143409821 17:6702158-6702180 CAGGAGCCTGGACAGGGGTGGGG - Intronic
1145124235 17:20286957-20286979 CAGGAGCCAGGACTTTCTTGGGG - Intronic
1145972446 17:28964325-28964347 CAGCAGCCTGGGCTGGTTAGTGG + Intronic
1146642196 17:34549952-34549974 CAGGAGCCTAGACCTGGGTGTGG + Intergenic
1147190185 17:38733876-38733898 CTGGAGCCTGTAGTTCTTTGGGG - Exonic
1151400240 17:73851129-73851151 CAGCAGCCTGGCCTTGTTTGTGG - Intergenic
1151572998 17:74936438-74936460 CGGGACACTGGACTGGTTTGTGG - Intronic
1153456026 18:5282807-5282829 CAGAGGCCTGGACTTGTAAGTGG + Intergenic
1154499370 18:14987550-14987572 CAGGACCCTGGACCTGTGTGGGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156918989 18:42496023-42496045 AAGGAGCTAGGACTTGGTTGAGG - Intergenic
1158974843 18:62702392-62702414 CAGGACCCTGAACTGCTTTGGGG + Intergenic
1161975442 19:7605855-7605877 GAGGAGCCTGGACTGGTGGGAGG - Intronic
1163020698 19:14479615-14479637 CAGAAGCCTGGAGAAGTTTGGGG - Intronic
1163513322 19:17748493-17748515 CTGGAGCCTGGACTTGGGGGGGG + Intronic
1163737099 19:18988231-18988253 CAGGAGCCTGTGGTGGTTTGGGG - Intergenic
1163804722 19:19388485-19388507 CAGGAGCCTGGAGGATTTTGTGG + Intronic
1164119263 19:22251036-22251058 CAGGAGCCTGAAGTTGTCTTGGG + Intergenic
1165460925 19:35943955-35943977 CAGGAGGCTGGACTGCCTTGAGG + Intronic
1168134697 19:54342410-54342432 CAGGAACCTGAACATATTTGAGG - Intergenic
1168352872 19:55686529-55686551 CGAGGGACTGGACTTGTTTGGGG + Intronic
926721614 2:15965540-15965562 CAGGAGGCTGGTCTGGTTGGAGG + Intergenic
929828850 2:45331456-45331478 CAAGATCCTGGGCATGTTTGAGG - Intergenic
930057752 2:47265069-47265091 AAGGAGCCTGGCCCTGTTTTGGG + Intergenic
930390128 2:50750175-50750197 CAGGAGCCTATACTATTTTGAGG + Intronic
930536633 2:52652463-52652485 CAGCAGCCTGGACCTGTTGCAGG + Intergenic
930744393 2:54866831-54866853 CAGGAGCCTTTTCTCGTTTGAGG - Exonic
931704944 2:64939474-64939496 CAGCAGCCTGGACGTGAGTGAGG - Intergenic
932889448 2:75579491-75579513 CAGGAGCTTGGACTTGAATGAGG - Intergenic
933139121 2:78771589-78771611 CACGGGGCTGGACATGTTTGAGG - Intergenic
934061493 2:88298257-88298279 CAGGAGCTTGGACATCTTTGGGG + Intergenic
934607750 2:95710358-95710380 AAGAAGGCAGGACTTGTTTGAGG + Intergenic
936080805 2:109431249-109431271 CAGCAGCCTGCACTGGTGTGAGG + Intronic
936541092 2:113352238-113352260 AAGAAGGCAGGACTTGTTTGAGG + Intergenic
937336023 2:121062803-121062825 CAGGGGCCTGGCCTTGTCTGGGG - Intergenic
937867201 2:126761407-126761429 CAGGAGCCTGGTCTGGTTTCAGG - Intergenic
939746153 2:145970828-145970850 CAATAGCATGGAGTTGTTTGTGG - Intergenic
946538807 2:220661151-220661173 AAGGAGATTGCACTTGTTTGAGG - Intergenic
948003967 2:234592179-234592201 CAGGACACTGCTCTTGTTTGAGG + Intergenic
1172198231 20:33106757-33106779 CAGGAGCCTTGAGTCGTTTGGGG + Intronic
1172909190 20:38393834-38393856 GAAGAGCCTGGACGTGGTTGAGG + Intergenic
1173159956 20:40645022-40645044 CTGCAGCCAGCACTTGTTTGTGG - Intergenic
1173263073 20:41453557-41453579 CAGGAGGCTGGCCTGGCTTGGGG - Intronic
1173401085 20:42726518-42726540 CAGAATCCTGGTTTTGTTTGTGG - Intronic
1173823836 20:46035021-46035043 CAAGAACATGGCCTTGTTTGAGG + Exonic
1174339511 20:49887038-49887060 CTGGAGGCTGGACGTGCTTGTGG + Intronic
1174361519 20:50031805-50031827 CAGGTGCCTGGACGTGTGTGTGG + Intergenic
1174390331 20:50214890-50214912 CAGGAGCCTGGACCAGGGTGGGG + Intergenic
1174634875 20:51990345-51990367 CAGGAAGCTGGACTTGAATGAGG - Intergenic
1175271420 20:57736718-57736740 CAGTAGCCTTGACATGTCTGTGG + Intergenic
1175436783 20:58958186-58958208 TAGGAGCCCTGATTTGTTTGGGG - Intergenic
1180499720 22:15921114-15921136 CAGGACCCTGGACCTGTGTGGGG + Intergenic
1183013304 22:34965434-34965456 CAGAAGCTTGGAATTGTTTTTGG + Intergenic
1183078889 22:35443759-35443781 CAGGTGCTTGCACTTGTTTGTGG + Intergenic
1184398553 22:44260296-44260318 CAAGAGGCTGGACTTGTGTTCGG + Intronic
1185047825 22:48537776-48537798 CAGGAGCCTGGCTTAGTCTGGGG - Intronic
1185066330 22:48633363-48633385 CAGGAGCATGGGTGTGTTTGTGG + Intronic
949320160 3:2800804-2800826 CAGGATTCTGAACATGTTTGAGG - Intronic
949875551 3:8624071-8624093 CAAGCGCCTGGGCTTATTTGTGG - Intronic
951432922 3:22628936-22628958 CAGGAGCCTTAACCTGTTTGGGG + Intergenic
951865207 3:27299797-27299819 CTGGATTCTGGACTTGCTTGGGG + Intronic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
954849387 3:53587468-53587490 CAGGAGCATGGACTCATTTTGGG + Intronic
955086537 3:55708170-55708192 CAGTAACATGGACTTCTTTGGGG - Intronic
957040741 3:75333634-75333656 CAGGGTCATGGACTTGTTTGTGG - Intergenic
958564599 3:95793316-95793338 AAGGGGCCTGGATTTGTTTGGGG + Intergenic
960428998 3:117545744-117545766 CAGGAACGAAGACTTGTTTGTGG - Intergenic
961045579 3:123705522-123705544 CAGGGTCGTGGACTTGCTTGTGG - Intronic
961746074 3:129064246-129064268 CAGGGGCCTGGAATTGCTGGCGG - Intergenic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
962942390 3:140137419-140137441 CAGGAACCTAGTCTAGTTTGTGG - Intronic
964157055 3:153599218-153599240 CAGGATACTGCACTTGATTGAGG + Intergenic
966020563 3:175203630-175203652 CAGGAGGCAGGACTAGATTGTGG - Intronic
968981203 4:3850578-3850600 CAGGAGCCTCTGCTTTTTTGGGG + Intergenic
969719894 4:8887860-8887882 CAGGAGGCTGGGGTTGTTTTTGG - Intergenic
970124213 4:12791289-12791311 CAGGAGACTGGAATTTTGTGAGG - Intergenic
971174359 4:24266469-24266491 AAGGTGCCTGGAATTGTTTGGGG + Intergenic
972319448 4:37959741-37959763 CAATAGCCTGGACTAGATTGGGG + Intronic
976615407 4:87070916-87070938 CAGGAGACAGGAATTGTTTAAGG + Intronic
977284711 4:95088335-95088357 CAGGAGCCTGGCATAGTTGGGGG + Intronic
978153505 4:105464260-105464282 CTGGATTCTGGACTTGTATGGGG + Intronic
983069482 4:163252097-163252119 AAGGAGCCTGGAATAATTTGAGG + Intergenic
983186322 4:164705205-164705227 CGGCAGCCTGCACTTGTCTGGGG - Intergenic
984071520 4:175119969-175119991 CAGGAACCTCAACTTTTTTGAGG + Intergenic
989612046 5:43303572-43303594 AAGGAGCTTGGACTTAGTTGAGG - Intronic
992286066 5:75236807-75236829 CAGGAGCCGGGACTTGTCGCAGG + Exonic
994801263 5:104380208-104380230 CAGGAGGCAGGACTTGACTGTGG + Intergenic
995934109 5:117487371-117487393 CAGGAGTCTGCACTTGCCTGGGG - Intergenic
997394205 5:133544817-133544839 CAGGGGCCTGGAAATATTTGGGG + Intronic
999888486 5:155950657-155950679 CAGGGGCCTGGAAGTCTTTGGGG - Intronic
1001034201 5:168285530-168285552 CAGGAGGCTGCTCTTGTTGGGGG - Intergenic
1002418103 5:179131475-179131497 CAGGAGGCTGGACAGGATTGGGG - Intronic
1003980957 6:11389377-11389399 CAGGAGCATGAACATGTGTGGGG - Intergenic
1005341491 6:24847653-24847675 CAGCCGCCTGGGCTTGTCTGGGG + Exonic
1005413541 6:25576561-25576583 CAGGAGCCAGGACTTGCATGGGG + Intronic
1006415814 6:33903312-33903334 CAGTAGCCCTGACTTCTTTGGGG - Intergenic
1007422716 6:41729183-41729205 CAGGGGTGTGGAGTTGTTTGTGG - Intronic
1011233192 6:85187149-85187171 CAGGAGGCAGGACTAGATTGCGG + Intergenic
1011511805 6:88109392-88109414 CATGAGCTTGGGCTTGTGTGAGG - Intergenic
1016404414 6:143715413-143715435 CTGGAGCCTGGGCCAGTTTGAGG - Intronic
1016981698 6:149860606-149860628 CATGAGCAGGGACTTGTTTGTGG + Intronic
1019503807 7:1380474-1380496 CAGAACCCTGGACTTGGATGAGG - Intergenic
1020226148 7:6281835-6281857 CAGGTGGCTGTACTTGTGTGAGG - Intergenic
1023649593 7:42355016-42355038 CACTAGCCTGGATTTGGTTGTGG - Intergenic
1024530592 7:50389255-50389277 CAGGAGCCTAGACATGTGTCAGG + Intronic
1025898731 7:65726651-65726673 CAGGAGTCGGGACTTGCATGGGG + Intergenic
1026537067 7:71247411-71247433 TAGGAGCCTGAAGTTATTTGTGG - Intronic
1026688297 7:72531490-72531512 CAGGCGCCTGGGCCTGGTTGAGG - Intergenic
1026723532 7:72853374-72853396 CAGGCGCCTGGGCCTGGTTGAGG - Intergenic
1029314892 7:99702556-99702578 CAGGTGTGTGGACTTGTTTCTGG + Intronic
1031017568 7:116592559-116592581 CAGGAGACGGGACTGGCTTGAGG + Intergenic
1031766273 7:125781513-125781535 CAGGAGCTTGGGGTTTTTTGGGG + Intergenic
1034044942 7:147917813-147917835 CAGGAGTCTGGACTTTATTCTGG - Intronic
1035607159 8:937581-937603 CAGGTCCCTGGAGTTGCTTGGGG + Intergenic
1036011724 8:4732886-4732908 CAGCAGGCTGGACATGTTTTAGG - Intronic
1036424724 8:8633771-8633793 GAGGAGCCAGGCCTTGTGTGTGG - Intergenic
1037858536 8:22388648-22388670 CAGGAGCCTGGAATCGTAGGGGG + Intronic
1039978335 8:42385663-42385685 CAGGAGCCTGGACTTTGTGCTGG - Intergenic
1040779550 8:51091843-51091865 CTGGAGGGTGGACTTTTTTGTGG - Intergenic
1041345866 8:56897410-56897432 CATGAGCCTGGACTTTCCTGTGG - Intergenic
1041393896 8:57373006-57373028 AAGAAGGCTAGACTTGTTTGAGG - Intergenic
1042431330 8:68710114-68710136 CAGGAGGCAGGACTAGATTGCGG + Intronic
1043750539 8:83928754-83928776 TTGTAGCCTGGGCTTGTTTGGGG + Intergenic
1043992830 8:86777300-86777322 CTTGAGCCTGGGCTTTTTTGTGG - Intergenic
1047347736 8:124044760-124044782 CCGAAGACTGGAGTTGTTTGCGG - Intronic
1048578596 8:135712277-135712299 CAGGAGAATGTCCTTGTTTGTGG - Intergenic
1049409528 8:142466248-142466270 CAGGGGCCTTGACTTTTCTGGGG + Intronic
1051223755 9:14877472-14877494 TAGGAGACTGGAATTATTTGGGG - Intronic
1053425227 9:38005901-38005923 CAGGTCCCTGGAATAGTTTGGGG + Intronic
1055048706 9:71958121-71958143 CAGGAAGCTGGTGTTGTTTGGGG + Intronic
1056579726 9:87882138-87882160 CATGAGCCAGGAGTGGTTTGGGG - Intergenic
1056779075 9:89535874-89535896 CAGGACCCTGCACTTGTCTTTGG - Intergenic
1057333937 9:94141670-94141692 CAGGAGCCCGCAGTTGTCTGGGG - Intergenic
1058003908 9:99895521-99895543 CAGGAACTAGGACTGGTTTGGGG - Intergenic
1059638022 9:116189733-116189755 CAGGACCCTGGACTTGCTGATGG + Intronic
1059900212 9:118916125-118916147 CAGGTGCATGGACTTGTTTCTGG + Intergenic
1060951972 9:127609790-127609812 CAGGATCCAGGACTTCTTAGTGG - Intergenic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1062446670 9:136598155-136598177 CAGTAGCCTGGACTGGCTCGAGG - Intergenic
1185986562 X:4841476-4841498 CAGCAAGCTGGACTTGTCTGAGG - Intergenic
1187651233 X:21409633-21409655 AAGGAACATGAACTTGTTTGTGG + Intronic
1190026278 X:46926216-46926238 CAGTAGGTTGGACTTTTTTGGGG + Intronic
1193696181 X:84709450-84709472 CAGGAGGCTTGACCTGTTGGCGG - Intergenic
1195504404 X:105640856-105640878 CAAGAGCCTGGACTTACTGGAGG - Intronic
1196228101 X:113189586-113189608 CAGCAGCCTGGCCATGTTTGTGG + Intergenic
1197518775 X:127472312-127472334 CAGGAGGCAGGACTAGATTGCGG + Intergenic
1197749455 X:129954662-129954684 TAGGAGTCTGGACTTTTATGTGG - Intergenic
1197847905 X:130823157-130823179 CAGTAGCCTGGTTTTGTTAGAGG - Intronic