ID: 1125747782

View in Genome Browser
Species Human (GRCh38)
Location 15:42008826-42008848
Sequence GTGTCAGAGAGTCCTCTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125747780_1125747782 -10 Left 1125747780 15:42008813-42008835 CCAGCAGTTTCCAGTGTCAGAGA 0: 1
1: 0
2: 1
3: 8
4: 202
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107
1125747775_1125747782 28 Left 1125747775 15:42008775-42008797 CCCAGGGTACACACCAGATACAT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107
1125747776_1125747782 27 Left 1125747776 15:42008776-42008798 CCAGGGTACACACCAGATACATA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107
1125747779_1125747782 15 Left 1125747779 15:42008788-42008810 CCAGATACATAGGAAATGGTGAA 0: 1
1: 0
2: 2
3: 31
4: 409
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125747782 Original CRISPR GTGTCAGAGAGTCCTCTCGA TGG Intronic