ID: 1125747782

View in Genome Browser
Species Human (GRCh38)
Location 15:42008826-42008848
Sequence GTGTCAGAGAGTCCTCTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125747779_1125747782 15 Left 1125747779 15:42008788-42008810 CCAGATACATAGGAAATGGTGAA 0: 1
1: 0
2: 2
3: 31
4: 409
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107
1125747780_1125747782 -10 Left 1125747780 15:42008813-42008835 CCAGCAGTTTCCAGTGTCAGAGA 0: 1
1: 0
2: 1
3: 8
4: 202
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107
1125747775_1125747782 28 Left 1125747775 15:42008775-42008797 CCCAGGGTACACACCAGATACAT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107
1125747776_1125747782 27 Left 1125747776 15:42008776-42008798 CCAGGGTACACACCAGATACATA 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG 0: 1
1: 0
2: 1
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125747782 Original CRISPR GTGTCAGAGAGTCCTCTCGA TGG Intronic
906172752 1:43741487-43741509 GTGCCAGAGAGTATTCTCCAGGG - Intronic
907421962 1:54353654-54353676 GGGTCAGAGGCTGCTCTCGAGGG + Intronic
914994873 1:152534801-152534823 GTGTAAGAGAGTCCTCCGTAAGG + Intronic
916138634 1:161675015-161675037 GTGTCAGAAAGTCCACGCCATGG - Intronic
916932083 1:169588985-169589007 CTTCCAGAGAGTCCTCTGGATGG - Exonic
921167189 1:212515434-212515456 GTGTCAGAGACTGCTCTGCAGGG - Intergenic
921478221 1:215634899-215634921 GTGTCAGCAAGGCCTCTCAAGGG - Intronic
922052993 1:222012072-222012094 GTCACAGAGATTCCTCTGGAAGG - Intergenic
1063541740 10:6941093-6941115 GTGTGAGAGAGACCTTTAGATGG - Intergenic
1070824230 10:79381532-79381554 GGGGCAGAGAGTCCTGTCAAGGG - Intergenic
1075653381 10:124144994-124145016 GTGCCAGGGAGTCCTTTCAAAGG + Intergenic
1076894474 10:133303195-133303217 CTCTCAGAGGGTCCTCTGGACGG + Intronic
1081598570 11:44476215-44476237 GTGTCAGGGAGTCCTCTGGGAGG + Intergenic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1083604634 11:63970829-63970851 GTGTCTGAGCTTCCTCTGGAGGG - Intergenic
1091278424 11:134368263-134368285 GTGTCAGAGTTTTCTCTCTAAGG + Intronic
1092208758 12:6632860-6632882 GTGCCAGAGACTCCTCTCTGAGG - Intronic
1097955422 12:65480569-65480591 GTGTGAGAGAGACCTCAGGATGG - Intronic
1099609455 12:84849086-84849108 GAGACAGAGAGTGCTCTGGAGGG + Intergenic
1099896553 12:88654908-88654930 GTGTGTGAGAGTCTTCTCTAAGG - Intergenic
1105267012 13:18829541-18829563 GTGTCACAGAGTCCAGTGGAAGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1113782525 13:112984946-112984968 GAGCCAGAGAGTCCTGTCGGGGG - Intronic
1115355182 14:32439339-32439361 GTGACAGAGAATCCTCTCCTAGG - Intronic
1122298545 14:100718988-100719010 GTTTCAGAGAGACCTCCAGAGGG + Intergenic
1124148567 15:27155842-27155864 GTTTCAGAGAGTGCTGACGAGGG - Intronic
1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG + Intronic
1136612049 16:31372217-31372239 GTGTCAGGGAGGCCTCCTGAAGG + Intronic
1143771656 17:9173023-9173045 GTGTCAGAGAGCCCTAGGGAAGG - Intronic
1144460582 17:15455592-15455614 GTGTAAGAGAGTGCTCAAGATGG - Intronic
1147401792 17:40184625-40184647 GCCTCAGAGTGTCCTCTCGGAGG - Exonic
1152698024 17:81805948-81805970 GTGTCAGTGTCTCCTCTCGGGGG + Intronic
1153561455 18:6375601-6375623 GTGACAAAGAGCCCTCTCGGAGG - Intronic
1153844121 18:9033217-9033239 GTGGCAGAGAGTCCCCACTACGG + Intergenic
1161155437 19:2730191-2730213 GTGTCAGAGGCTCCTCTAGAGGG + Intronic
1161571298 19:5032152-5032174 GAGTCAGACTGTCCTCTCCACGG - Intronic
1163060702 19:14759360-14759382 GGGTCAGAGAGTCCTCAGTAAGG - Intronic
1163101495 19:15099945-15099967 GTGTCAGTTTGACCTCTCGAGGG - Intergenic
1163320064 19:16569463-16569485 GTGACAGAGAGCCTTCTAGAAGG + Intronic
1163549451 19:17957462-17957484 AAGTCAGAGAGGCCTCTCTAGGG + Intronic
1164055423 19:21618094-21618116 ATGTCAGGGTGTCCTCTGGAAGG - Intergenic
1168175924 19:54627736-54627758 ATGTCAGAGAGCTCTCTCTATGG + Intronic
1168273822 19:55265423-55265445 GGGTCAGTGAGGCCTCTAGAGGG - Intronic
925670251 2:6303413-6303435 ATGTCAGAGAGTCATCTAGCTGG - Intergenic
926233836 2:11024539-11024561 GGATCAGAGAGCCGTCTCGAGGG + Intergenic
931598054 2:63972173-63972195 ATGTAAAAGAGTCCTTTCGAAGG + Exonic
932171981 2:69565697-69565719 GTGGGAGAGTGTCCTCTCCATGG + Intronic
932171989 2:69565744-69565766 GTGGCAGAGTATCCTCTCCACGG + Intronic
932172009 2:69565885-69565907 GTGGCAGAGTGTCCTCTCCACGG + Intronic
932172039 2:69566073-69566095 GTGGGAGAGTGTCCTCTCCATGG + Intronic
934496743 2:94809195-94809217 GTGTCATAGAGTCCAATGGAAGG - Intergenic
935723259 2:105998095-105998117 GGGTAAGAGAGTCCTCACTAAGG + Intergenic
937574379 2:123401433-123401455 GTGTCAGAGAATCCTTCCTACGG + Intergenic
937593985 2:123650774-123650796 GTGTGTGAGAATCCTCTAGAAGG - Intergenic
937879732 2:126856461-126856483 GTTCCAGAGAGTCTTCTAGAAGG - Intergenic
945485981 2:210396147-210396169 GTGTAAGAGAATCATCTGGAGGG + Intergenic
948467143 2:238158110-238158132 GTGGCAGAGAGGCCTCTGGGCGG - Intergenic
948555276 2:238805897-238805919 GTAACAGGGAGTCCTCTCCATGG + Intergenic
948792177 2:240384738-240384760 GGGGCAGAGAGTCCTCTGGGGGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171888049 20:30675944-30675966 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1174339821 20:49888659-49888681 GGGTCAGAGCGCCCTCTAGAGGG + Exonic
1175069767 20:56323581-56323603 GGGTTAGAGAGTACTCTAGAAGG + Intergenic
1176247514 20:64104508-64104530 GTGTCTGACGGTCCTCTCCATGG - Intergenic
1176247549 20:64104645-64104667 GTGTCTGACGGTCCTCTCCATGG - Intergenic
1176247604 20:64104841-64104863 GTGTCCGACGGTCCTCTCCATGG - Intergenic
1176247618 20:64104890-64104912 GTGTCCGACAGTCCTCTCCATGG - Intergenic
1176852077 21:13928049-13928071 GTGTCACAGAGTCCAATGGAAGG - Intergenic
1179921730 21:44510999-44511021 GTGTCTCAGAGTCCCCTTGAAGG - Intronic
1182548748 22:31090147-31090169 GTGTCAGAGGGGCCTCTGGTGGG - Exonic
1182967803 22:34538673-34538695 TTTTCAGAGAGTCCTCTCCTTGG + Intergenic
954520286 3:51219078-51219100 GAGTCAGAGGGTCCTCTAAAAGG - Intronic
956005541 3:64774859-64774881 GTATCAGACCCTCCTCTCGATGG + Intergenic
968351231 3:198054994-198055016 GTGTCATAGAGTCCAATGGAAGG - Intergenic
969873859 4:10121674-10121696 TTGCCAGTGAGTCCTCTAGAGGG + Intergenic
970848079 4:20566974-20566996 GTGTCACAGAGTCCCCTCATGGG - Intronic
971758323 4:30731775-30731797 AGGTCAGGGAGTCCTCTGGATGG + Exonic
972148859 4:36064430-36064452 ATTTCAGAAAGTCCTCTTGATGG + Intronic
979186939 4:117808696-117808718 TTGTCAGAGAGTCCTTTACATGG - Intergenic
991651840 5:68863530-68863552 GTGTCAGAGAGTGCCCTCTGTGG - Intergenic
999697274 5:154198278-154198300 GTGGCAGAGAGTTCTCTTGAGGG + Intronic
1001002285 5:168018993-168019015 GTATCAGAGAGTACTTTAGAGGG + Intronic
1002162223 5:177321226-177321248 GTGTCAGGGTGTCCTCTTCAAGG + Intergenic
1005520905 6:26599472-26599494 AGGTCATAGAGTCCTCTCAATGG + Exonic
1018475648 6:164138210-164138232 GTGTCAGAAACTCCCCTGGAAGG - Intergenic
1023887186 7:44367641-44367663 GTGTCAGCGTCTCCTCTGGAGGG - Intergenic
1028577034 7:92363595-92363617 GTGTCAAAGAATCTTCTTGAAGG + Intronic
1031856503 7:126928925-126928947 GTATCAGAGAATCCTCTTGCAGG + Intronic
1033048474 7:137983234-137983256 GTGGTAGATAGTCCTCTGGAAGG - Intronic
1035106299 7:156444435-156444457 GTGGGAGAGAGTCCTCGCGTCGG + Intergenic
1035324158 7:158054144-158054166 GTGTCAGTGACTTCTCTCTAGGG - Intronic
1043654318 8:82642467-82642489 GTGACAGAGACTCGTCTCAAAGG + Intergenic
1044523513 8:93225911-93225933 GTGTCAGAGAGCCGTCTCAGAGG + Intergenic
1048279075 8:133091385-133091407 GTGTCAGAGGGTCCTCTGGATGG - Intronic
1049211691 8:141389583-141389605 GTGTCAGGGATTCCTCTGCAGGG + Intergenic
1052875258 9:33555077-33555099 GTGTCATAGAGTCCAATGGAAGG + Intronic
1052875301 9:33556101-33556123 GTGTCATAGAGTCCAATGGAAGG + Intronic
1053500713 9:38588248-38588270 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1053500760 9:38589272-38589294 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1053533817 9:38906250-38906272 GTGTCAGAGAGTGATCACAAAGG - Intergenic
1053660407 9:40271253-40271275 GTGTCATAGAGTCCAATGGAAGG + Intronic
1053910777 9:42900604-42900626 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1054206040 9:62130679-62130701 GTGTCAGAGAGTGATCACAAAGG - Intergenic
1054361409 9:64124169-64124191 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1054372525 9:64417483-64417505 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1054524205 9:66105035-66105057 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1054632318 9:67457691-67457713 GTGTCAGAGAGTGATCACAAAGG + Intergenic
1054680153 9:67907247-67907269 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1057472530 9:95370404-95370426 GTGTCACAGAGACATCTCCAGGG - Intergenic
1057680112 9:97172650-97172672 GTGTCATAGAGTCCGATGGAAGG - Intergenic
1057680156 9:97173674-97173696 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1058078050 9:100670414-100670436 GGGTAAGAGAGTCCTCAGGAAGG - Intergenic
1060617065 9:125026943-125026965 GTGTCAGAGACTCTTCACCATGG + Intronic
1192217820 X:69176230-69176252 TTGGCAGAGATTCCTCTCCAAGG + Intergenic