ID: 1125748086 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:42010981-42011003 |
| Sequence | TCCCGATGTCTTTTAGGTCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 70 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 66} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1125748086_1125748088 | -3 | Left | 1125748086 | 15:42010981-42011003 | CCAGGACCTAAAAGACATCGGGA | 0: 1 1: 0 2: 0 3: 3 4: 66 |
||
| Right | 1125748088 | 15:42011001-42011023 | GGATAGTCTTAATCTAACCCAGG | 0: 1 1: 0 2: 1 3: 5 4: 62 |
||||
| 1125748086_1125748089 | 2 | Left | 1125748086 | 15:42010981-42011003 | CCAGGACCTAAAAGACATCGGGA | 0: 1 1: 0 2: 0 3: 3 4: 66 |
||
| Right | 1125748089 | 15:42011006-42011028 | GTCTTAATCTAACCCAGGCAAGG | 0: 1 1: 0 2: 0 3: 13 4: 126 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1125748086 | Original CRISPR | TCCCGATGTCTTTTAGGTCC TGG (reversed) | Intronic | ||