ID: 1125748088

View in Genome Browser
Species Human (GRCh38)
Location 15:42011001-42011023
Sequence GGATAGTCTTAATCTAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125748087_1125748088 -9 Left 1125748087 15:42010987-42011009 CCTAAAAGACATCGGGATAGTCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1125748088 15:42011001-42011023 GGATAGTCTTAATCTAACCCAGG 0: 1
1: 0
2: 1
3: 5
4: 62
1125748086_1125748088 -3 Left 1125748086 15:42010981-42011003 CCAGGACCTAAAAGACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1125748088 15:42011001-42011023 GGATAGTCTTAATCTAACCCAGG 0: 1
1: 0
2: 1
3: 5
4: 62
1125748084_1125748088 -2 Left 1125748084 15:42010980-42011002 CCCAGGACCTAAAAGACATCGGG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1125748088 15:42011001-42011023 GGATAGTCTTAATCTAACCCAGG 0: 1
1: 0
2: 1
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125748088 Original CRISPR GGATAGTCTTAATCTAACCC AGG Intronic