ID: 1125748089

View in Genome Browser
Species Human (GRCh38)
Location 15:42011006-42011028
Sequence GTCTTAATCTAACCCAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125748084_1125748089 3 Left 1125748084 15:42010980-42011002 CCCAGGACCTAAAAGACATCGGG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1125748089 15:42011006-42011028 GTCTTAATCTAACCCAGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 126
1125748087_1125748089 -4 Left 1125748087 15:42010987-42011009 CCTAAAAGACATCGGGATAGTCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1125748089 15:42011006-42011028 GTCTTAATCTAACCCAGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 126
1125748086_1125748089 2 Left 1125748086 15:42010981-42011003 CCAGGACCTAAAAGACATCGGGA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1125748089 15:42011006-42011028 GTCTTAATCTAACCCAGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125748089 Original CRISPR GTCTTAATCTAACCCAGGCA AGG Intronic