ID: 1125751974

View in Genome Browser
Species Human (GRCh38)
Location 15:42035455-42035477
Sequence CCATTCCCAGCAGGAGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125751974_1125751980 9 Left 1125751974 15:42035455-42035477 CCTCGTTCTCCTGCTGGGAATGG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1125751980 15:42035487-42035509 CCATGCTTTCCCAGCGAGTAAGG 0: 1
1: 0
2: 1
3: 1
4: 85
1125751974_1125751985 26 Left 1125751974 15:42035455-42035477 CCTCGTTCTCCTGCTGGGAATGG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1125751985 15:42035504-42035526 GTAAGGCTCAGTTGAAGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 157
1125751974_1125751984 25 Left 1125751974 15:42035455-42035477 CCTCGTTCTCCTGCTGGGAATGG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1125751984 15:42035503-42035525 AGTAAGGCTCAGTTGAAGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 169
1125751974_1125751983 21 Left 1125751974 15:42035455-42035477 CCTCGTTCTCCTGCTGGGAATGG 0: 1
1: 0
2: 0
3: 17
4: 203
Right 1125751983 15:42035499-42035521 AGCGAGTAAGGCTCAGTTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125751974 Original CRISPR CCATTCCCAGCAGGAGAACG AGG (reversed) Intronic
900340454 1:2186316-2186338 TCATCCCCAGCAGGTGAGCGTGG + Intronic
900793048 1:4692061-4692083 CCATTCCCGGAAGGAGCACAGGG - Intronic
900816753 1:4853231-4853253 CCATGCCAAGCAGGAGCAGGGGG - Intergenic
902393345 1:16118961-16118983 CCGGGCCCAGCAGGAGAAAGGGG + Intergenic
904703971 1:32376654-32376676 ACATTCCCTGAAGGAGAACCTGG - Exonic
906201706 1:43964684-43964706 CAGTTCCCGGCAGGAGCACGGGG - Intronic
911196425 1:94999709-94999731 CCTTTCCCAGCAGGATAAGAAGG - Intronic
912263493 1:108131903-108131925 CCATTCCCAGTGGGAGAAATTGG + Intergenic
912710859 1:111948773-111948795 CCATGCACAGCAGGAGAGGGAGG + Intronic
912962852 1:114211444-114211466 CCATTCCCACCAGTAGGAAGCGG + Intergenic
917510205 1:175663309-175663331 TCATTCCCAGGAGGAGTATGAGG + Intronic
918092302 1:181308115-181308137 CCAGTCCCAGGAGGAGCAGGAGG - Intergenic
919664321 1:200277812-200277834 CCAGTCCCACCATGAGTACGAGG - Intergenic
919800358 1:201350470-201350492 CCATGCTGAGCAGGAGAAGGAGG - Intergenic
921053091 1:211524925-211524947 CCATTGCCAGGAGGATAAAGCGG + Intergenic
922077913 1:222266254-222266276 CCCTTCCCAGCAAGAGCAAGGGG + Intergenic
924324970 1:242886453-242886475 CCATGGCCAGCAGGAGCACATGG - Intergenic
924438219 1:244064624-244064646 CCACTCTCACCAGGAGAAGGTGG + Intergenic
1063003470 10:1946226-1946248 CAATTCCCACCAGGAAAACACGG - Intergenic
1063782537 10:9342592-9342614 GCTTTCCCAGCAGGAGAAGGAGG - Intergenic
1066224839 10:33372097-33372119 CCATTCAAAGCAGTAAAACGAGG - Intergenic
1067004507 10:42648110-42648132 CCCTGCCCAGCAGCAGAAGGAGG - Intergenic
1069686239 10:70320869-70320891 CCATTCTCAGGAAGAGAAGGAGG - Intronic
1069835214 10:71303924-71303946 CCATTCCCAGGAGGACAGCTAGG - Intergenic
1072624710 10:97103832-97103854 CCATTCCCAGCAGGTGACCTTGG + Intronic
1076916868 10:133427362-133427384 CCACTCCCAGCAGGAAAAAGGGG - Intergenic
1076936969 10:133572162-133572184 CCACTCCCAGCAGGAAAAAGGGG - Intergenic
1077685991 11:4292547-4292569 CCATTCTCAGGAGGTGAGCGTGG + Intergenic
1080425066 11:32147450-32147472 CCTTTCCCAAAAGGAGAATGGGG - Intergenic
1080612850 11:33919822-33919844 GCATTCCCAGCAGTAGAAAGAGG - Intergenic
1080878986 11:36301575-36301597 CCCTTCCCAGCTGGAGGAAGTGG + Intronic
1082946193 11:58763451-58763473 CCATTCCGAACAGGAGAAATTGG - Intergenic
1083993778 11:66262113-66262135 TCCTTCCCAGGAGGAGAAGGGGG + Exonic
1086995653 11:93353162-93353184 CCATTCCAAACAGGAGAAATTGG + Intronic
1087160763 11:94946074-94946096 GCATTCCCCACAGGAGAACATGG - Intergenic
1087550132 11:99638611-99638633 CCATTCCCAACGGGAGAAATCGG + Intronic
1090082738 11:123624891-123624913 CCATTCCCAGGAGGAAAAGGTGG + Intronic
1094273440 12:28642534-28642556 CCATTCTCAGGAGGAGAAAATGG + Intergenic
1095345541 12:41144745-41144767 CCATTCCCAGGAGGAGGAGTCGG - Intergenic
1095979230 12:47961663-47961685 GCATTCCCCACAGGAGAAAGAGG + Intergenic
1095979528 12:47963559-47963581 CCAAGCCCGCCAGGAGAACGCGG - Intronic
1099137641 12:78927969-78927991 CAAATCCCAGCAGAAGAACACGG - Intronic
1099352647 12:81592174-81592196 CCATTCCAAACAGGAGAAATTGG - Intronic
1103928593 12:124437279-124437301 CCATTCCCCGGAGGAGATCAGGG - Intronic
1103991874 12:124804786-124804808 CCATTGCCAGCTGGAGGACGGGG + Intronic
1104969094 12:132523147-132523169 CCACTCCCAGCAGGAGCTGGAGG - Intronic
1105602816 13:21902276-21902298 CCATGCCCAGGAGGAGAATTCGG - Intergenic
1106625949 13:31421163-31421185 ACATTCCCAGAAGAAGAATGGGG - Intergenic
1112091521 13:96089739-96089761 CCCTTCTCAGCAGGGGAACGTGG - Intergenic
1112871324 13:103974415-103974437 GCATTCCCAACAGGAGACCCAGG - Intergenic
1115291552 14:31778276-31778298 CCTTTCCCAGGAGGTGAATGGGG + Intronic
1117632805 14:57710777-57710799 CCATTCCAAGCAGGAGAAGTTGG - Intronic
1119379317 14:74218536-74218558 CCATTCCCAGAGGGAGACAGGGG - Intergenic
1119593905 14:75916272-75916294 CCATTCCCAACAGTACACCGGGG - Intronic
1122397815 14:101446771-101446793 CCATTCCCACCAAGAGGAAGAGG + Intergenic
1122942952 14:104990989-104991011 GCATTCCCTGCAGGAGCACTGGG - Intronic
1125751974 15:42035455-42035477 CCATTCCCAGCAGGAGAACGAGG - Intronic
1129458693 15:75689202-75689224 CAACTCCCGGCAGGAGAACTCGG + Exonic
1129725103 15:77897670-77897692 CAACTCCCGGCAGGAGAACTCGG - Intergenic
1132079663 15:98853283-98853305 CCATTTCCAGCAGTACAATGTGG + Intronic
1132208390 15:100002411-100002433 CCATTCCCAGCACGTGACCACGG + Intronic
1132582188 16:690019-690041 TCAATCCCAGCAGGGGAGCGAGG + Exonic
1133090128 16:3397638-3397660 ACATTCCTTGCAGGAGAACATGG - Exonic
1134482680 16:14632796-14632818 CCACTCCCAGCCGGAGGAAGTGG - Exonic
1135283615 16:21173993-21174015 CCAATCCTAGGAGGAGAACGTGG - Exonic
1135347487 16:21701506-21701528 CCATTCCCAGCAGGGGAGGAGGG + Intronic
1139842357 16:69891818-69891840 CCATTCCCAGGAGGGGGACCAGG - Intronic
1139891788 16:70257807-70257829 ACATTCCCAGGAGGAAAAGGGGG - Intronic
1140243307 16:73224834-73224856 CCTTTCCAAGCAGAAGATCGTGG - Intergenic
1140590921 16:76351796-76351818 CAATTCTCATCAGGAGAAAGAGG - Intronic
1141178987 16:81739550-81739572 CCCTTCCCTGGAGGAGTACGGGG - Intronic
1143278269 17:5730845-5730867 CAAGTCCCAGCAGGAGAACCAGG + Intergenic
1143674065 17:8417864-8417886 CCCACCCCAGCAGGAGAAGGAGG - Intronic
1143757432 17:9077179-9077201 CCATTCCCAACTGGAGAATTGGG - Intronic
1145225826 17:21127240-21127262 CCATTCCCAGCAGCGGAAACTGG - Intronic
1146548196 17:33757172-33757194 TCAGCCCCAGGAGGAGAACGAGG + Intronic
1148180217 17:45600207-45600229 CCTATCCCAGCAGGAGAGGGAGG - Intergenic
1148210307 17:45804571-45804593 ACATTCCCGGCAGGTGAACATGG + Intronic
1148268680 17:46245688-46245710 CCTATCCCAGCAGGAGAGGGAGG + Intergenic
1148797911 17:50206035-50206057 CCAGTCCTAGGAGGAGAACTTGG + Intergenic
1150007781 17:61480201-61480223 GCACTACCAGCACGAGAACGGGG + Exonic
1150107379 17:62472365-62472387 CCATGCCCAGCAGGAAAGAGAGG + Intronic
1151540707 17:74763354-74763376 CCCTGCCCTGCAGGTGAACGGGG + Exonic
1156092452 18:33487906-33487928 CCATTCCTAGGAGCATAACGAGG - Intergenic
1156348844 18:36285377-36285399 CCATTCTCAGCAGCAGATCTAGG + Intergenic
1159393777 18:67830313-67830335 CCATTACCAGCAGGAGGCTGTGG + Intergenic
1160627107 18:80218343-80218365 CCATTCCAAACAGGAGAAATTGG + Intronic
1161394774 19:4039049-4039071 CCTTGCCCCGCAGGAGACCGGGG + Exonic
1161766010 19:6209307-6209329 CCATTCCCAGCATCAGAGTGTGG - Intergenic
1162982540 19:14248761-14248783 CCTTCCCCAGCAGGAGAGAGGGG + Intergenic
1163458113 19:17420534-17420556 CCAGAACCCGCAGGAGAACGTGG + Exonic
1165946104 19:39443489-39443511 CCATTCCCTGCAGAAAAAAGAGG - Intronic
1166137105 19:40784154-40784176 CTGTACCCAGCAGGGGAACGTGG + Intronic
1167596441 19:50430799-50430821 CCACTCCCAGGAGGAGGAGGAGG + Exonic
1167848561 19:52184436-52184458 CCATTGGCAGGAGGAGAACAGGG - Intergenic
1168578874 19:57536689-57536711 CCATAACCAGCAAGAGAACAAGG - Intronic
925012559 2:496639-496661 CCATAAGCAGCAGGAAAACGGGG - Intergenic
925453264 2:3990198-3990220 CCATTCCCAATAGGAGAAATTGG + Intergenic
925652647 2:6107712-6107734 CCATTCCCAGAAGGAAAGCATGG - Intergenic
925874812 2:8302635-8302657 CCATTCCCTGCAGCAGGAGGGGG + Intergenic
926367419 2:12145902-12145924 CCAGAACCAGCAGGAGAAAGGGG + Intergenic
927200268 2:20573856-20573878 CCATCCCCACCAGGACAAGGAGG + Intronic
928086148 2:28347648-28347670 CCATTCCCATCAGGGGAGAGGGG + Intergenic
928193709 2:29197267-29197289 ACATTCCCAGCAGGAGCTTGGGG + Intronic
931166665 2:59756240-59756262 CCCCTCCCAGCAGGAGAGCGAGG + Intergenic
933726535 2:85430534-85430556 CCAGGCCCAGGAGGAGGACGAGG + Intronic
934128158 2:88919528-88919550 CCATTCCCACCAGCAGAGGGAGG - Intergenic
934962658 2:98690470-98690492 CCATTCCCACCAGCATAATGAGG + Intronic
935102454 2:100009911-100009933 CCTTTCCCAGCAGAAGCAGGTGG + Intronic
935627096 2:105180431-105180453 CCTTGCCCAGCAGAAGAACCAGG - Intergenic
936938803 2:117861937-117861959 CCACTCCCGGCAGGAGGACCTGG + Intergenic
938262293 2:129904714-129904736 GCATGCCCAGGAGGAGTACGTGG - Intergenic
939398276 2:141660129-141660151 TCAATCCCAGCAAGAGAACCTGG - Intronic
942155320 2:173121757-173121779 CCATTCCCAGGAGGTGATGGTGG - Intronic
945890717 2:215427771-215427793 CCTTTCCTAGCAGAAGAACCAGG + Intronic
946185104 2:217976381-217976403 CCCTTCCCAGCAGGAGGAAAAGG + Intronic
946844974 2:223850980-223851002 CCATTCCAAACAGGAGAAATTGG - Intergenic
947182103 2:227420470-227420492 CCATTCACAGGAGCAGAAAGTGG - Intergenic
947620022 2:231583954-231583976 TCATTCCCAGGAGGAAAACTGGG - Intergenic
1169096750 20:2906335-2906357 CCAATCCCAGAAGGAGATAGAGG + Intronic
1170775354 20:19370707-19370729 CCTATCCCAGCAGGAGAAATAGG + Intronic
1172858262 20:38025101-38025123 CCATTCCTGGTAGGAGAAGGGGG - Intronic
1173362326 20:42355755-42355777 CCAGTCCAAGCAGGGGGACGGGG - Intronic
1175762994 20:61573707-61573729 CCATTCCTAGCAAGAGGAAGGGG + Intronic
1176015620 20:62929650-62929672 CTTTACCCAGGAGGAGAACGTGG + Intronic
1178905580 21:36633257-36633279 CGAGTCCCATCAGGAGAATGTGG + Intergenic
1179361627 21:40714555-40714577 CCATTCCAAAAAGGAGAAAGAGG - Intronic
1179366763 21:40765926-40765948 CCATTCCCATCAGCAGCACAGGG - Intronic
1179971641 21:44839102-44839124 CCATCTCCAGCAGGAGAGCCTGG + Intergenic
1183040450 22:35173909-35173931 CCATGACCAGGAGGAGAACCAGG + Intergenic
1184235778 22:43182326-43182348 CCACTCCCAGCTGGAGGAGGAGG + Intronic
951597688 3:24335874-24335896 CCATTCCCACCAGGAAACTGGGG - Intronic
953770927 3:45778130-45778152 CCCTTCTCAGCAGGAGCACCTGG - Intronic
954363115 3:50132863-50132885 CCAATCCCAGCAGCAGACCTCGG + Intergenic
955419872 3:58725407-58725429 CCATTGCCAGCAGAAGCAGGGGG - Intronic
960055971 3:113276615-113276637 CAATCCCCAGCAAGAGAAGGGGG - Intronic
961821074 3:129575934-129575956 CCTTTCCCAGCAGGAGCCCGTGG - Intronic
964767963 3:160196980-160197002 CCATTCCCAGCAGCAGTCCCTGG + Intergenic
965355573 3:167669008-167669030 CCTTTTCCTGCAGAAGAACGTGG + Intergenic
965424225 3:168501134-168501156 CAATTCCCAGGAGGAAAATGTGG + Intergenic
967501668 3:190204516-190204538 CCATTCCAAACAGGAGAAATTGG - Intergenic
967858827 3:194136969-194136991 GCATTCCAAGCTGGAGAAGGCGG + Exonic
975066249 4:70067714-70067736 CCATTTCCAGACGGAGAAAGTGG - Intergenic
983262126 4:165468691-165468713 CCAGTTACAGCAGGAGACCGTGG - Intronic
985215691 4:187650896-187650918 CCAGTGCCAGGAGGAGAAAGGGG - Intergenic
985809645 5:2073576-2073598 CCATTCCAAGAAGGAGAAATTGG - Intergenic
990176818 5:53116939-53116961 ACATTACCAGCAGGATAACTAGG + Intergenic
990941376 5:61206126-61206148 CCATTCCAAACAGGAGAAATTGG + Intergenic
990967754 5:61467995-61468017 CCCTTCCCAGCTGGAGAAACAGG - Intronic
992528166 5:77630937-77630959 CCATACCCAGCCGGAGACTGTGG + Intronic
993996997 5:94735155-94735177 CCACTCCCACCAGGAGGACACGG + Intronic
996611283 5:125383013-125383035 CCATTCCCAAAAGGAGAAATTGG - Intergenic
997269467 5:132524813-132524835 CCATTCCCAGCATGTGACCTTGG + Intergenic
997603538 5:135156651-135156673 CCATTTCCAGCATGGGAAGGAGG - Intronic
997840414 5:137234356-137234378 CCTTGCCCAACAGGAGAAGGTGG - Intronic
999331168 5:150674335-150674357 ACATTCCCACCAGCAGAAAGAGG + Intronic
1000209254 5:159095910-159095932 CCAGTCCCAGCTGCAGAACTTGG - Intronic
1001128100 5:169038989-169039011 CAATCCCCAGCAGAAGAAGGGGG - Intronic
1001419297 5:171574460-171574482 CCAAACCCAGCAGCAGAACTGGG + Intergenic
1002166089 5:177347304-177347326 CCATTCCCAGCATGTTCACGGGG + Intronic
1002338392 5:178496177-178496199 CTGTTCCCAGCAGGTGAAAGGGG - Intronic
1004306257 6:14504454-14504476 CCATTCCCAGAAGGAGGAAATGG + Intergenic
1004573951 6:16874489-16874511 CCATTCACAGCTGGACAAGGTGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1006285974 6:33094640-33094662 GCATTTCCAGCAGGAGAAGCAGG + Intergenic
1012733235 6:102907782-102907804 CCACTGACAGCAGGATAACGTGG - Intergenic
1018426899 6:163691197-163691219 CTGTGCCCAGCTGGAGAACGGGG + Intergenic
1018799247 6:167210000-167210022 CCATGCCCAGGAGGTGAAGGGGG - Intergenic
1019751107 7:2730412-2730434 CCATGCCCAGCAGCACAACACGG - Exonic
1020005513 7:4781930-4781952 CCATGCCCAGCAGGCCCACGTGG + Intronic
1022371252 7:29773619-29773641 ACATTCCCACCAGGAGCATGTGG - Intergenic
1022470129 7:30676941-30676963 CCATTCCCAGTAGGACATTGCGG + Intronic
1022782893 7:33603663-33603685 CCTTACCCAGAAGGAGAACCAGG - Intronic
1023234581 7:38070993-38071015 CCTTTCCCAGCAGCAGCACATGG + Intergenic
1024055919 7:45659820-45659842 CCATGCCCAGCAGGACAGCAGGG - Intronic
1024415163 7:49097342-49097364 CCATTCCCAGTGGGAGAAATTGG + Intergenic
1028380190 7:90191641-90191663 CCATTCCTAGCAGGGAAACTGGG + Intronic
1032961462 7:137040232-137040254 CAATTCCCTGGAGGAGAACTTGG + Intergenic
1034448566 7:151125746-151125768 CCACTCCCAGCAGGAGCTGGGGG - Intronic
1034739768 7:153462954-153462976 CCATTCCAAATAGGAGAAAGTGG - Intergenic
1034959286 7:155355102-155355124 GCCTTCCCAGCAGGAGACAGGGG - Intergenic
1035135349 7:156698041-156698063 CCATTCCAAACAGGAGAAATTGG + Intronic
1035349806 7:158238073-158238095 ACGTTCCCAGCAGGAGGCCGCGG - Intronic
1037643280 8:20768204-20768226 CCATTCCTAGAAGGATAACCTGG + Intergenic
1039025482 8:33253257-33253279 TCAGTCCCAGCAAGAGAACCAGG + Intergenic
1039503338 8:38033639-38033661 CCATTCCCAGCAGGAGTGACTGG - Intronic
1039510580 8:38088813-38088835 CCTTGCCCAGCAGGGGAAGGAGG + Intergenic
1039825476 8:41170221-41170243 GGATTCCCAGAAGGAGAAAGAGG + Intergenic
1041567545 8:59297077-59297099 TCATTCCCAGCAGTAAAACCTGG + Intergenic
1044932012 8:97260123-97260145 TAACTCCCAGCAGGAGAAGGAGG + Intergenic
1047185265 8:122627413-122627435 CCATCCCCAGCAGAAAAATGAGG + Intergenic
1047747067 8:127853199-127853221 CCATACCCAGCAGGAGGCCGGGG + Intergenic
1048437800 8:134433861-134433883 CCATGCCCAGCAGGAGAGGAAGG + Intergenic
1049541923 8:143212553-143212575 GCTTTCCCAGCAAGAGACCGAGG + Intergenic
1049987986 9:970168-970190 CCACTCCCAGCGGGAGGGCGGGG + Intergenic
1051736763 9:20208221-20208243 GCATTCCAAGCAGGTTAACGTGG + Intergenic
1056000006 9:82205202-82205224 CCATTCCCAGCTGTAGACCTGGG + Intergenic
1057487848 9:95499920-95499942 CCAATACAAGCAGGAGAACAGGG + Intronic
1057576922 9:96250092-96250114 CCATTCTCAGCTGGAGGAAGAGG + Intronic
1059269064 9:113060933-113060955 CCAGCCCCAGCCGGAGAGCGAGG - Intergenic
1059270200 9:113066382-113066404 CCAGCCCCAGCCGGAGAGCGAGG - Intergenic
1059271336 9:113071832-113071854 CCAGCCCCAGCCGGAGAGCGAGG - Intergenic
1059272467 9:113077276-113077298 CCAGCCCCAGCCGGAGAGCGAGG - Intergenic
1059273602 9:113082718-113082740 CCAGCCCCAGCCGGAGAGCGAGG - Intergenic
1059274738 9:113088164-113088186 CCAGCCCCAGCCGGAGAGCGAGG - Intergenic
1059364411 9:113774869-113774891 CCATGCCCAGCAAGAAAACCAGG - Intergenic
1059484569 9:114616944-114616966 AAATTCCCAGGAGGAGAAGGAGG - Intronic
1060407757 9:123381321-123381343 CCCTTCCCACCAGCAGAACCTGG + Exonic
1061684889 9:132267499-132267521 CCATTCCCATAAGGGGAACTAGG + Intronic
1062503905 9:136863170-136863192 GCATTCCCTGCAGGGGAACCAGG + Intronic
1186035813 X:5422165-5422187 ACATTCCCAGCAGGGGAGAGGGG + Intergenic
1187874191 X:23790099-23790121 TCACTCCTAGCAGGAGAAGGTGG - Intergenic
1190723723 X:53172383-53172405 CCGTTCCCAGCAGGACAAGCTGG + Intergenic
1191034289 X:56008328-56008350 TCAGTCCCAGCAAGAGAACCTGG - Intergenic
1192733141 X:73821087-73821109 CCATCCCCAGCTGAAGAAAGGGG + Intergenic
1198677675 X:139148102-139148124 CCTTTCCCAGGAGGATAACCTGG + Intronic
1198941351 X:141960013-141960035 CCTTTCCCACCAGTAGAACCAGG + Intergenic
1201222500 Y:11785444-11785466 CCATGGCCAGCAGGAGCACATGG - Intergenic
1201634879 Y:16111839-16111861 ACATTCCCAGCAGGGGAGCGGGG - Intergenic
1202369716 Y:24188477-24188499 CAACTCCCAGCAGGAGAACTGGG + Intergenic
1202501069 Y:25481640-25481662 CAACTCCCAGCAGGAGAACTGGG - Intergenic