ID: 1125753443

View in Genome Browser
Species Human (GRCh38)
Location 15:42046075-42046097
Sequence CAGTAGGAGTGGATGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125753443_1125753453 22 Left 1125753443 15:42046075-42046097 CCAGAATCCATCCACTCCTACTG 0: 1
1: 0
2: 1
3: 9
4: 174
Right 1125753453 15:42046120-42046142 AAGCCACCTCCATTTCTCTCTGG 0: 1
1: 1
2: 5
3: 28
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125753443 Original CRISPR CAGTAGGAGTGGATGGATTC TGG (reversed) Intronic
900278284 1:1847669-1847691 CAGCAGGAGTTGATTGTTTCAGG - Intronic
900592266 1:3465384-3465406 CAGGAGGAGAGGACGGAGTCGGG + Intronic
903082044 1:20818409-20818431 CAGGAGGAGTGTATGAGTTCAGG + Intronic
904498241 1:30899668-30899690 CATTAGAAGTGGGTGGATTTTGG - Intronic
910123031 1:83811237-83811259 CACCAGGAGTGGATGGATTCAGG - Intergenic
912156620 1:106929013-106929035 CAGAAAGAGGAGATGGATTCAGG + Intergenic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915726183 1:158019335-158019357 CAGAAGGACCAGATGGATTCTGG + Intronic
915740907 1:158117822-158117844 GAGTAGGAGTGGAAAGAGTCTGG + Intergenic
915850082 1:159312279-159312301 CCATTGGATTGGATGGATTCTGG + Intergenic
919130129 1:193440835-193440857 CAGTAGGAGTAATTGGATCCTGG + Intergenic
919976224 1:202614813-202614835 CAGCTGGAGTGGATGGATCACGG + Intronic
923564327 1:235065327-235065349 AAGTAGGAGAGGAGGGAATCAGG + Intergenic
924070542 1:240274017-240274039 CAGTAGGAGTGAACGAATTATGG - Intronic
924693166 1:246371864-246371886 CAGAAGGAGAAGATGGCTTCAGG - Intronic
1064186230 10:13164034-13164056 CCATAGGAGTGGTAGGATTCTGG + Intronic
1066433203 10:35372247-35372269 AAGGAGGAGTGGCTGCATTCAGG + Intronic
1066488912 10:35875206-35875228 CAGTGGGAGTTGTTGGCTTCTGG + Intergenic
1067308991 10:45094512-45094534 CAGTGGGAGTTGTTGGCTTCTGG + Intergenic
1070170665 10:73930353-73930375 CAGTAGGGGTGGAAGGATAAAGG + Intergenic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1072839090 10:98750574-98750596 CGGTAGAAGTGGTTGGTTTCTGG + Intronic
1074370555 10:112897759-112897781 GGGTGGGAGTGGATGGATGCTGG + Intergenic
1074945935 10:118280639-118280661 CACTAGGAGAGGATGTATACAGG + Intergenic
1080918639 11:36686449-36686471 GCGGAGGAGTGGATGGATTGAGG + Intergenic
1082916140 11:58439677-58439699 CAGTATGAATGGATGCATTCAGG + Exonic
1083250079 11:61460747-61460769 CAGTGGGGGTGGATGGATCTTGG - Intronic
1086388741 11:86338587-86338609 GAGGAGGAGTGAATGGATTAGGG + Intronic
1088725498 11:112630731-112630753 CAGTTGGTGTGGATGGACTTTGG - Intergenic
1089607776 11:119651647-119651669 CAGTGGGAGTGGGGGGATTGGGG - Intronic
1089710372 11:120310216-120310238 GAGGAGGAGTGGTTGCATTCTGG + Intronic
1090554668 11:127861376-127861398 CAGTAGCAGTGGTTGTACTCGGG - Intergenic
1091404055 12:197987-198009 GTGTAGGTGTGGATGGATGCGGG - Exonic
1091409112 12:227652-227674 TTGTAGGTGTGGATGGATGCAGG - Exonic
1091860406 12:3776448-3776470 GAGGAGAAGTGGATGGAGTCAGG + Intergenic
1092999173 12:13979689-13979711 CAGTGGGGGTGGATGTATGCAGG - Intronic
1099097863 12:78398078-78398100 GAAGAGAAGTGGATGGATTCAGG - Intergenic
1100289589 12:93201076-93201098 CAGGAGAAGTGGATGGATTTGGG - Intergenic
1100724143 12:97391074-97391096 TAGTAGGAGCCGATAGATTCAGG + Intergenic
1103243497 12:119435030-119435052 GGGGAGAAGTGGATGGATTCAGG + Intronic
1104092666 12:125528877-125528899 CAGGATGAGGGGATGGTTTCAGG + Intronic
1109122474 13:58475270-58475292 CAGTAAAAGGGGATGGATTTAGG + Intergenic
1109346736 13:61124281-61124303 CAGACGGAGGGGATGGTTTCAGG - Intergenic
1110848135 13:80213078-80213100 TACTAGGAGTTGAGGGATTCAGG + Intergenic
1114660452 14:24340175-24340197 CTGTAGGAGTGGGTTGATTGTGG - Intergenic
1116275998 14:42832402-42832424 GAGCAGGAGTGGATGGTTTCAGG + Intergenic
1116963368 14:50989846-50989868 CACTAGGATTGGCTGGAGTCTGG + Intronic
1117654274 14:57938694-57938716 CAGTAGGACTGGGTGGAGCCTGG + Intronic
1117790504 14:59335769-59335791 AAGCAGGAGAGGTTGGATTCTGG - Intronic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1118432464 14:65733730-65733752 GTGTAGAAATGGATGGATTCTGG - Intronic
1118786741 14:69052247-69052269 CAGAAGATGTGGATGAATTCAGG - Exonic
1124359423 15:29024863-29024885 CAGGAGGAGCGGATGGAAGCAGG + Intronic
1124450085 15:29780130-29780152 CAGGTGGAGGGGATGGTTTCGGG + Intronic
1125753443 15:42046075-42046097 CAGTAGGAGTGGATGGATTCTGG - Intronic
1126564998 15:50085572-50085594 CACTAGAAGTGTATGGATTGTGG + Intronic
1128377877 15:67090125-67090147 CACTGGGAGTGGCTGGAGTCGGG + Intronic
1128776522 15:70324595-70324617 AAGTAGGAGTGGAGGCATCCCGG - Intergenic
1128793537 15:70449603-70449625 AAGTATGAGTGGATGGATAGAGG + Intergenic
1129332093 15:74832912-74832934 GAGTAGTAGTTGATGTATTCAGG - Intergenic
1131481063 15:92782260-92782282 CAGTAGAAGTGGCTTGGTTCTGG + Intronic
1132574793 16:659393-659415 CTGGAGGAGTGGGGGGATTCGGG + Intronic
1132858345 16:2057608-2057630 CAGGAGGCGCGGATGGATACAGG - Intronic
1137264873 16:46860386-46860408 CTTCAGGAGTGGCTGGATTCAGG - Intergenic
1137352745 16:47727925-47727947 GAGAAGAAGTGGATGGAATCTGG + Intergenic
1138320119 16:56104618-56104640 CAGTAGGAGAGGGTGTTTTCAGG - Intergenic
1144772799 17:17769275-17769297 GAGTAGAAGTGGATGGATGGGGG + Intronic
1147042247 17:37727888-37727910 GAGTGGGTGTGGAGGGATTCGGG + Intronic
1153482825 18:5564751-5564773 CAGTAGGAGTGGGAGGAGTTGGG - Intronic
1158575458 18:58633518-58633540 CAGGAGGATTGCTTGGATTCAGG + Intergenic
1160579284 18:79874581-79874603 CAGTAGGAGAGAATCAATTCTGG - Intronic
1162859253 19:13493249-13493271 CAAGAGGAGTGGGTGGATTTAGG - Intronic
1164876418 19:31693883-31693905 GAGGAGGAGAGGAGGGATTCAGG - Intergenic
1166145340 19:40830740-40830762 CAGCAGGAGGGCATGGTTTCTGG - Intronic
1167654918 19:50757343-50757365 CAGAAGGACTGGATGAAGTCAGG - Intergenic
1168585127 19:57585534-57585556 TAGAAGAAGTGGCTGGATTCTGG + Intronic
925874977 2:8303785-8303807 CAGTAGGAGAGGATGAACGCTGG - Intergenic
927896467 2:26785975-26785997 CACTGGGAGTCGCTGGATTCGGG + Exonic
928849886 2:35733290-35733312 CAATGGGAATTGATGGATTCTGG + Intergenic
928910610 2:36417054-36417076 CAATGGGAGTGGCGGGATTCTGG - Intronic
930143776 2:47980461-47980483 CAGTAGGTGTGGGTGGGTTCTGG + Intergenic
931120941 2:59219030-59219052 CTGTAGGTGTGGGTGGCTTCAGG + Intergenic
931751476 2:65334246-65334268 CAGAAGTAGAGAATGGATTCTGG - Intronic
932527784 2:72490201-72490223 CAGTAGAAGTGGATAGGTTTGGG + Intronic
936055690 2:109260409-109260431 CAGTTGGCTTGGATGGGTTCAGG + Intronic
937301148 2:120843159-120843181 CAGTGGGAGTGAATGAATGCTGG + Intronic
937675487 2:124585434-124585456 CAGGAAGAATGGATGGATCCAGG + Intronic
938840093 2:135152252-135152274 CAGAAGGAGAGGGTGGATTCTGG + Intronic
941015096 2:160346561-160346583 CAGGAGGAGTGGACGGATGATGG - Intronic
943143467 2:184012689-184012711 CTGTAGGTGTGGATGGCTTATGG - Intergenic
943266297 2:185737504-185737526 AAGTAGGAGTAGATAGAATCGGG + Intergenic
943666668 2:190616168-190616190 CAGTATGTGTGGATGGAGTGAGG + Intergenic
943949829 2:194119354-194119376 CAGGAGGAGTGCTTGAATTCAGG + Intergenic
944982120 2:205133417-205133439 CAGTAGGTGTGGAGGGAGCCTGG - Intronic
1168964059 20:1888255-1888277 GGGAAGGAGTGGTTGGATTCTGG + Intergenic
1169892190 20:10465329-10465351 AAGTGGGAGTGGCTGGATTCCGG - Intronic
1173233549 20:41222176-41222198 AAGAAGAAGTGGCTGGATTCTGG + Intronic
1179461911 21:41541646-41541668 CAGAGGGAGCAGATGGATTCAGG + Intergenic
1180834298 22:18922162-18922184 CAGCAGGACTTGATGGCTTCAGG - Intronic
1181064177 22:20297935-20297957 CAAAAGGAGTGGATGAATCCAGG - Intergenic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1182355884 22:29722065-29722087 CAGGAGGAGGGGATGGATGAGGG - Intronic
1185408213 22:50669028-50669050 CAGTAGGAATTGTTGGATACAGG - Intergenic
1203284387 22_KI270734v1_random:147461-147483 CAGCAGGACTTGATGGCTTCAGG - Intergenic
949743073 3:7258733-7258755 CAGAAGGAGATGATGGATTGTGG - Intronic
950295705 3:11828387-11828409 TCGTAGCATTGGATGGATTCTGG - Intronic
951730750 3:25808010-25808032 TAAAAGAAGTGGATGGATTCCGG - Intergenic
954470053 3:50686010-50686032 CAGGATGAGGGGATGGTTTCAGG + Intronic
955131834 3:56177532-56177554 CAGGAGGAGTGGATTCTTTCTGG + Intronic
955348303 3:58176908-58176930 CAGTAGGAGTGGGTGGGGTGGGG + Intergenic
961325602 3:126107516-126107538 CACTAGGATTGGATGGACTTGGG - Intronic
961636039 3:128333571-128333593 CATTAGAAGTGAATGGAATCAGG + Intronic
961863773 3:129938726-129938748 CAGTAAGGGAGGATGAATTCAGG - Intergenic
963831782 3:150016421-150016443 GAAGAGGAGTGGGTGGATTCAGG + Intronic
964088100 3:152842629-152842651 CAGCAGCTGTGGATGGAGTCAGG + Intergenic
967306768 3:188066993-188067015 CAGCAGGAGTGAGAGGATTCTGG + Intergenic
967903172 3:194477790-194477812 CTGTAGGAGTGGATGAAGTGAGG - Intronic
968055142 3:195685881-195685903 CAGTAGGAGTGAATGGCTGGGGG - Intergenic
968100757 3:195963336-195963358 CAGTAGGAGTGAATGGCTGGGGG + Intergenic
969418269 4:7075000-7075022 CAGTAGGAGTGGGGGAATTTGGG - Intergenic
970716692 4:18934990-18935012 CAGTAAGAGTGGATTGAGACAGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
974064279 4:57063245-57063267 AAGTTGGAGGGGTTGGATTCAGG - Intronic
977418288 4:96763791-96763813 CAGGAGGAGTGTATGGGTGCTGG + Intergenic
982569968 4:157036588-157036610 CAGTAGTAGTGGTTGGAGTTAGG + Intergenic
985560944 5:585402-585424 CAGGTTGAATGGATGGATTCAGG + Intergenic
987714273 5:21546536-21546558 CAGTAGGAGTTGAAGGAATGGGG + Intergenic
987906773 5:24088176-24088198 CAGTGGGAATGAATGGATTGGGG - Intronic
988516051 5:31905673-31905695 GAGTAAGAGTGGATTTATTCAGG + Intronic
990193598 5:53288964-53288986 CAGTGGGATCGGATGGATCCTGG - Intergenic
991625508 5:68596716-68596738 CAGGGTGAGGGGATGGATTCAGG + Intergenic
992415490 5:76548912-76548934 CAGGAGGAGTGGATTTGTTCAGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993575755 5:89598367-89598389 CAGTAAGAATGGATGGGTTAAGG - Intergenic
995624247 5:114059103-114059125 GAGGAGAAGTGGATAGATTCAGG + Intergenic
996405388 5:123098544-123098566 CAGTTCGAGTGGAGGGATACTGG + Intronic
998101977 5:139442057-139442079 CAGTTTTAGTGGCTGGATTCAGG - Intronic
998394518 5:141810053-141810075 CAGAAGGGGTTGATGGATCCAGG - Intergenic
1001373778 5:171234582-171234604 CAGTGGGAGTGGTCAGATTCTGG + Intronic
1004750203 6:18554742-18554764 CAGGTGGAGTGGACTGATTCAGG + Intergenic
1005149488 6:22732609-22732631 CAGCAGGGGTGGATGGGTGCCGG + Intergenic
1005312871 6:24575295-24575317 CAGTATGCATGGATGGATTTTGG + Intronic
1006409696 6:33865535-33865557 AAGTAGCAGTGGTTGGTTTCGGG - Intergenic
1007683217 6:43648759-43648781 CTGTGGAAGTGGTTGGATTCTGG + Intronic
1008756648 6:54803713-54803735 TAATAGAAGTGGATGAATTCAGG + Intergenic
1009002453 6:57735543-57735565 CAGTAGGAGTTGAAGGAATGGGG - Intergenic
1019667792 7:2260858-2260880 CAGTAGGAGTTTATGGCTTGAGG - Intronic
1023105980 7:36763688-36763710 CAGCAGCAGAGGATGGATGCTGG + Intergenic
1024749836 7:52452687-52452709 CACTAGGTGTTGCTGGATTCTGG - Intergenic
1026385172 7:69839680-69839702 TAGTAGGAGTGGGGGTATTCAGG + Intronic
1029581891 7:101441858-101441880 CAGGAGGGGTGCATGGATGCTGG - Intronic
1030263313 7:107589220-107589242 CAGGAGCAGGGGATGGTTTCGGG + Intronic
1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG + Intergenic
1036588420 8:10146534-10146556 AACTAGGAGTGGCTGGATGCAGG + Intronic
1037049024 8:14345806-14345828 CAGTAGGAAGGGATGGAGTTTGG - Intronic
1038145499 8:24891552-24891574 GATTATGAGAGGATGGATTCAGG + Intergenic
1041337353 8:56801204-56801226 CAGTAGGACTGCATGCCTTCTGG - Intergenic
1041568364 8:59306689-59306711 GACTAGGATTTGATGGATTCTGG - Intergenic
1043147532 8:76676831-76676853 CTGGAGGAGGGGAGGGATTCAGG + Intergenic
1043674654 8:82936527-82936549 CAATAAGAGTGGATGGATGGAGG + Intergenic
1045558902 8:103241655-103241677 CAGGAGGAGTGGCTGAGTTCAGG - Intergenic
1048064562 8:130954478-130954500 CAGTAGGTGTGGGTGGGGTCAGG - Intronic
1050624666 9:7490096-7490118 CTTTAGGAGTGGCTTGATTCAGG + Intergenic
1051166418 9:14266781-14266803 CAACAGGAATGGATAGATTCTGG - Intronic
1051491015 9:17665321-17665343 CAATACAAGTGGATGGATCCTGG - Intronic
1051822144 9:21181002-21181024 CAGTAGTGGTGGATGGGTTGTGG - Intergenic
1051827180 9:21233661-21233683 CAGTAGTGGTGGATGGGTTGTGG - Intronic
1053935623 9:43147421-43147443 CAGCAGGAGTGGGTGGATTGTGG - Intergenic
1054278064 9:63105854-63105876 CAGCAGGAGTGGGTGGTTTGTGG + Intergenic
1054298751 9:63354563-63354585 CAGCAGGAGTGGGTGGTTTGTGG - Intergenic
1054396773 9:64659080-64659102 CAGCAGGAGTGGGTGGTTTGTGG - Intergenic
1054431414 9:65164284-65164306 CAGCAGGAGTGGGTGGTTTGTGG - Intergenic
1054498963 9:65857243-65857265 CAGCAGGAGTGGGTGGTTTGTGG + Intergenic
1055648973 9:78388536-78388558 CAGTGGGAGTGATTGGATCCTGG + Intergenic
1055817034 9:80218856-80218878 CCGTCGGAGAGGATGGTTTCCGG - Intergenic
1058672745 9:107374281-107374303 GGGAAGGAGTGGTTGGATTCTGG + Intergenic
1062078770 9:134607516-134607538 CAGGAGGTGGGGCTGGATTCAGG - Intergenic
1185851035 X:3488946-3488968 TTGTAGGTGTGGATGGCTTCAGG + Intergenic
1186527057 X:10258326-10258348 CAGTAGCAGTTGGTGGAGTCAGG + Intergenic
1194914760 X:99691972-99691994 CAGTAGTACTGGATGCATTCTGG - Intergenic
1199309062 X:146301478-146301500 AAGTATGAGAGGATGTATTCAGG + Intergenic
1200871704 Y:8106839-8106861 CAGTAGATGTGCATGGGTTCAGG + Intergenic
1201618824 Y:15931994-15932016 AAGTAGGAGAGGATGGTGTCTGG + Intergenic