ID: 1125754715

View in Genome Browser
Species Human (GRCh38)
Location 15:42055660-42055682
Sequence CAATCTGGACATTTTAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125754715_1125754720 7 Left 1125754715 15:42055660-42055682 CCTAAATTAAAATGTCCAGATTG No data
Right 1125754720 15:42055690-42055712 GCACATTTAACTAAATGTGTAGG No data
1125754715_1125754721 8 Left 1125754715 15:42055660-42055682 CCTAAATTAAAATGTCCAGATTG No data
Right 1125754721 15:42055691-42055713 CACATTTAACTAAATGTGTAGGG No data
1125754715_1125754722 26 Left 1125754715 15:42055660-42055682 CCTAAATTAAAATGTCCAGATTG No data
Right 1125754722 15:42055709-42055731 TAGGGTAATAGTGTGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125754715 Original CRISPR CAATCTGGACATTTTAATTT AGG (reversed) Intergenic
No off target data available for this crispr