ID: 1125755458

View in Genome Browser
Species Human (GRCh38)
Location 15:42061208-42061230
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125755458_1125755462 18 Left 1125755458 15:42061208-42061230 CCTCCCAAGTTCTGATCCTAAGA No data
Right 1125755462 15:42061249-42061271 GAAATGCTTCATAAATACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125755458 Original CRISPR TCTTAGGATCAGAACTTGGG AGG (reversed) Intergenic
No off target data available for this crispr