ID: 1125759104

View in Genome Browser
Species Human (GRCh38)
Location 15:42085002-42085024
Sequence GGTGTGGACCAGCAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125759104_1125759115 15 Left 1125759104 15:42085002-42085024 CCTTGTCCCTGCTGGTCCACACC 0: 1
1: 0
2: 3
3: 33
4: 335
Right 1125759115 15:42085040-42085062 CCCTCCCCAAGCGTCTGCTCTGG 0: 1
1: 0
2: 1
3: 17
4: 188
1125759104_1125759117 16 Left 1125759104 15:42085002-42085024 CCTTGTCCCTGCTGGTCCACACC 0: 1
1: 0
2: 3
3: 33
4: 335
Right 1125759117 15:42085041-42085063 CCTCCCCAAGCGTCTGCTCTGGG 0: 1
1: 0
2: 1
3: 15
4: 176
1125759104_1125759118 17 Left 1125759104 15:42085002-42085024 CCTTGTCCCTGCTGGTCCACACC 0: 1
1: 0
2: 3
3: 33
4: 335
Right 1125759118 15:42085042-42085064 CTCCCCAAGCGTCTGCTCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125759104 Original CRISPR GGTGTGGACCAGCAGGGACA AGG (reversed) Intronic
900318009 1:2069045-2069067 GGTGGTGACCAGCAGGAACCAGG - Intronic
900934819 1:5758615-5758637 AGTGTAGACTAGCAGGGCCAGGG + Intergenic
901438338 1:9263002-9263024 GGTGTTGGCAAGGAGGGACAAGG - Intronic
901472651 1:9468279-9468301 AGAGAGGACCGGCAGGGACATGG + Intergenic
901529964 1:9846664-9846686 GGTATTCACCTGCAGGGACAGGG + Intergenic
902337913 1:15764566-15764588 GGTGTGGCCCAGCAGGCAGGCGG + Exonic
902371385 1:16009251-16009273 GGTGTGGACCTGCTGGGTCTGGG + Intergenic
902513506 1:16978456-16978478 TGGGTGGGCCAGCAGGGACTGGG - Intronic
902621257 1:17652283-17652305 GGTGTGGCCCAGCGTGGGCAGGG - Intronic
902741201 1:18439520-18439542 GGGGTGGGGCAGCAGGGTCAGGG + Intergenic
903178880 1:21595565-21595587 GGTGTGCACAAGCAGGGCCTGGG - Intergenic
904004538 1:27356909-27356931 GGTGGGGGCCAGGCGGGACAGGG - Intronic
904328316 1:29741916-29741938 GGTGGGGAGGAGGAGGGACAGGG - Intergenic
907322617 1:53615135-53615157 GAGGTGGGCCAGGAGGGACAGGG - Intronic
907515952 1:54993620-54993642 GGTGGGGTGCAGCAGGGCCAGGG - Intergenic
907920133 1:58904070-58904092 GGTGGGGGCCAGCAGGGTCAGGG - Intergenic
910159770 1:84260379-84260401 GGTGTGGATCACAAAGGACAGGG + Intergenic
913192592 1:116426216-116426238 GATGAGGACAAGAAGGGACAGGG + Intergenic
913225121 1:116692295-116692317 GGCGAAGAGCAGCAGGGACATGG - Intergenic
913230306 1:116735764-116735786 GGAGAGGCCCAGGAGGGACAGGG - Intergenic
915662375 1:157414997-157415019 TGTCTGAACCGGCAGGGACATGG - Intergenic
915989739 1:160502070-160502092 GGTGTGGCCCAGAGGGCACATGG + Intronic
916818018 1:168372156-168372178 GGTAAGGAACAGCAGGGATAGGG - Intergenic
919981372 1:202644375-202644397 GGTGAGCACCAGGAGGGGCAGGG + Intronic
921360897 1:214330257-214330279 GGAGTGTACCACCAAGGACAAGG + Exonic
922755994 1:228097267-228097289 GGTGGGGGCCAGCAGGGAGTGGG + Intronic
922804240 1:228377432-228377454 GGTGGGGGCCACCAGGGCCAGGG - Intronic
923506934 1:234612020-234612042 GGTGTGCAACAGCAGGGCCTGGG - Intergenic
923687156 1:236161284-236161306 GGTGTGGACCAGCCAGGAAGAGG - Intronic
924251919 1:242141384-242141406 GGAGTGGAGAACCAGGGACAAGG - Intronic
924708619 1:246517364-246517386 GGTGAGGTCAAGCTGGGACAGGG + Intergenic
1064297119 10:14088909-14088931 GGTGTGGAGGAGCAGGGGCGGGG + Intronic
1064701253 10:18023881-18023903 AGTGAGGAGTAGCAGGGACAGGG + Intronic
1065125914 10:22574028-22574050 GGTGGAAACCAGCAGGGACAAGG - Intronic
1065971473 10:30809435-30809457 GGTGGGGACCAAGAAGGACAAGG - Intergenic
1066007244 10:31156599-31156621 GGTCTGGACCACCTGGGACCTGG + Intergenic
1066151875 10:32630206-32630228 CTTGAGGAACAGCAGGGACAGGG - Intronic
1067021824 10:42807182-42807204 GCTGGGGAACAGCAGGGACGTGG - Intronic
1067053208 10:43037085-43037107 GATGGGGACCAGGAGGTACATGG - Intergenic
1067164782 10:43856561-43856583 GTTGGGGAGCAGCAGGGACCAGG + Intergenic
1069716349 10:70523655-70523677 GGTGTGGAGCACCATGGAGATGG + Intronic
1069777438 10:70935188-70935210 GGTGTGGAGCAGATGGCACAGGG + Intergenic
1070140609 10:73734674-73734696 GGTGTGCACCAGCAGGCTAAGGG + Intergenic
1070735968 10:78863878-78863900 GGAGAGGACCTGCAGGGACCAGG + Intergenic
1073051422 10:100669785-100669807 GGTGTGGGCCAGCATGGCCATGG + Intergenic
1073479926 10:103779977-103779999 GGTGTGGTTCAGCCGGGAAAAGG - Intronic
1073570407 10:104576514-104576536 GATGTGGGCCAGCCAGGACAGGG - Intergenic
1075065913 10:119288751-119288773 GGTGAGGAACAGCAGGGAGGAGG - Intronic
1075712893 10:124540284-124540306 CGTGTGGACCTGGAGGGCCAGGG - Intronic
1076402467 10:130193054-130193076 GCTTTGGAGAAGCAGGGACAGGG - Intergenic
1076627948 10:131833471-131833493 GGTGGGGACCAGCCTGGGCACGG - Intergenic
1076778235 10:132709852-132709874 GCTGTGGGCCTGCAGGCACATGG - Intronic
1077252268 11:1565926-1565948 GTGCTGGACCTGCAGGGACAGGG + Exonic
1077556751 11:3229749-3229771 GCTGTAGGACAGCAGGGACATGG - Intronic
1078511435 11:11987209-11987231 GGTGAAGACCAGCTGGGAAAGGG - Intronic
1079181390 11:18196811-18196833 GGTGTTCAGCAGCAGGGACAGGG - Intronic
1079735676 11:23994228-23994250 AGTGAGGAACAGCAGGCACAGGG - Intergenic
1081671833 11:44946843-44946865 GCTGGGGCCCAGCAGGGACCTGG - Intronic
1083318408 11:61829909-61829931 GGTGTGGGCCAGCAGGGCCAGGG + Intronic
1083552734 11:63602344-63602366 TGTAGGGACCAGCAAGGACAGGG + Intronic
1083782614 11:64925971-64925993 CGAGGGGACCAGCAGGGCCATGG + Intronic
1083808615 11:65089593-65089615 GGTGTGGCCCAGAAGGCACCTGG + Intronic
1084272365 11:68036171-68036193 GGTGGGGATGAGCAGTGACAGGG + Intronic
1084547394 11:69821282-69821304 GGTGTAGAGCAGGAGGGGCATGG - Intergenic
1084641664 11:70429965-70429987 TGTGTGGCCCTGCAGGGGCAGGG - Intronic
1085046499 11:73356687-73356709 GCTGTGGGACAGGAGGGACAAGG - Exonic
1088470765 11:110185933-110185955 TGAGTGGACCACCAGGGAAAGGG + Intronic
1088737284 11:112738121-112738143 GGTGAGGGACAGCAGGGTCAAGG - Intergenic
1089048581 11:115526088-115526110 GGTGTGGACCAGGAGATAGAGGG - Intergenic
1089215572 11:116832671-116832693 GGTGTCGTCCAGTGGGGACATGG + Intronic
1089521792 11:119069344-119069366 GGTGAGTCCCAGCAGGGAAATGG + Exonic
1089564535 11:119363879-119363901 GGTGGAGAGCAGCAGGGACGGGG + Intronic
1090360355 11:126168020-126168042 GGTGTGGAGCCACAGGGACCTGG - Intergenic
1091196036 11:133731369-133731391 GGTGAGGTCCAGGAGGGACATGG + Intergenic
1091196200 11:133732784-133732806 GGTGAAGACAAGGAGGGACAAGG + Intergenic
1092280352 12:7093169-7093191 GGTGTGGAGCAAGAGGGACTCGG + Intronic
1093187131 12:16033274-16033296 GCTGTGAAACAGCAGGGAAAAGG + Intronic
1094498270 12:31002691-31002713 GGTGCTAACTAGCAGGGACATGG - Intergenic
1094783344 12:33818272-33818294 GGGGTGGGCCAGCAGGGATGGGG + Intergenic
1096192908 12:49631797-49631819 GGGCTGGAACAGGAGGGACAGGG - Intronic
1096973791 12:55686940-55686962 GGTGGGGTCCAGCAGGACCATGG - Intronic
1100555054 12:95685068-95685090 TGTTTGGACCAGCCTGGACATGG - Intronic
1100806735 12:98293145-98293167 GGTGGGGACAGCCAGGGACAAGG - Intergenic
1100875263 12:98955321-98955343 AGAGTGGAACAGCAGGTACAGGG + Intronic
1102001649 12:109561283-109561305 GGTGAGGACCTGGAGGGACTTGG + Intronic
1102124286 12:110468134-110468156 GGTGAGGATCTGCGGGGACAAGG - Intronic
1102809903 12:115815169-115815191 TGTGTGGCACAGCAGGGTCAAGG - Intergenic
1103191472 12:119005524-119005546 GGTGTGGTGGAGAAGGGACAGGG + Intronic
1103454446 12:121053813-121053835 GGACTGGACCTGGAGGGACAGGG + Intergenic
1104740136 12:131165958-131165980 GGTGGAAACCAGCAGGGCCAAGG + Intergenic
1104866839 12:131960996-131961018 GGTCTGGACCTGCTGGGACAAGG - Exonic
1104885389 12:132104364-132104386 GGTCTGGACCTGCTGGGACAAGG - Exonic
1105783954 13:23729192-23729214 AATGGGGAGCAGCAGGGACAGGG + Intergenic
1105881035 13:24606872-24606894 AGTGAGGAGCAGCAGGGCCAGGG + Intergenic
1106668203 13:31875294-31875316 GGTGTGGACCAGAGTGGAAAAGG + Intergenic
1107817239 13:44255074-44255096 GGTGTTGTCCAGCAGGAACAAGG - Intergenic
1108884708 13:55165561-55165583 GTTGTGGCGCAGCAGGGGCAGGG - Intergenic
1113374177 13:109748863-109748885 GGGGTGGAGCGGGAGGGACAGGG + Intergenic
1113618544 13:111697630-111697652 GCTCTGGCCCAGCAGGGACTTGG - Intergenic
1113624073 13:111782891-111782913 GCTCTGGCCCAGCAGGGACTTGG - Intergenic
1116297735 14:43135056-43135078 TGTGTAGACCAGAAGGGACTTGG - Intergenic
1119323502 14:73745251-73745273 CTTGTGGGCCAGCAGGGAGAAGG - Intronic
1120055451 14:79918782-79918804 GTGGTGGACCAGCAGGTAGAAGG + Intergenic
1121820812 14:96964464-96964486 GGTCAGGACCAGCAGGCAGAGGG - Intergenic
1122965062 14:105119621-105119643 GATGTGGAACCGCAGGGGCAGGG + Intergenic
1125759104 15:42085002-42085024 GGTGTGGACCAGCAGGGACAAGG - Intronic
1126049580 15:44673966-44673988 GGTGTGCCCAAGCAGGGGCATGG - Intronic
1126134640 15:45378456-45378478 CGCGTGGACCAGCCGGGCCAGGG - Exonic
1127259879 15:57319837-57319859 GGTGTGGACCAGGTGGGCCGCGG + Intergenic
1127399949 15:58575503-58575525 GGTGTGGCCCAGCACCGCCAGGG + Intergenic
1128087275 15:64894805-64894827 GGTGTGGCCCTGCAGAGAGAGGG + Intronic
1128331847 15:66761215-66761237 GGGGTGGGGCAGGAGGGACAGGG - Intronic
1128549874 15:68591149-68591171 GGCGTGGAACAGCAGTGACAGGG + Intronic
1128784397 15:70384113-70384135 GGTGTGAAGCTGCAGGGTCAGGG - Intergenic
1129222217 15:74137549-74137571 GGTGAGGAACAGGAGAGACAGGG + Intronic
1129820439 15:78598084-78598106 GGTGTGGAAAAGCAGAGACTTGG + Intronic
1129871693 15:78945373-78945395 GGTGGGGACACGCAGGGAGATGG - Intronic
1129871722 15:78945466-78945488 GGTGAAGACAGGCAGGGACATGG - Intronic
1129871729 15:78945498-78945520 GGTGGGGACAGGCAGGGAGATGG - Intronic
1129871773 15:78945624-78945646 GGTGGGGACAGGCAGGGACATGG - Intronic
1129871784 15:78945655-78945677 GGTGGGGATAAGCAGGGACATGG - Intronic
1129871807 15:78945720-78945742 GGTGGGGACAGGCAGGGAGATGG - Intronic
1129871817 15:78945752-78945774 GGTGGAGACAGGCAGGGACATGG - Intronic
1129871834 15:78945815-78945837 GGTGGGGACAGGCAGGGACGTGG - Intronic
1129871844 15:78945847-78945869 GGTGGGGACAAGCAGGGACATGG - Intronic
1129871855 15:78945879-78945901 GGTGGGGACAGGCAGGGAGATGG - Intronic
1129871867 15:78945911-78945933 GGTGGAGACAGGCAGGGACATGG - Intronic
1129871906 15:78946034-78946056 GGTGGGGACAGGCAGAGACATGG - Intronic
1129871915 15:78946065-78946087 GGTGGGGACTGGCAGGGATATGG - Intronic
1129871963 15:78946225-78946247 GGTGGGGACAGGCAGGGAGATGG - Intronic
1130036169 15:80363369-80363391 AGTGAGGAGCAGCAGGGCCATGG - Intronic
1132146750 15:99433707-99433729 CCTGTGGAACAGCACGGACAAGG + Intergenic
1132553574 16:563485-563507 GGAGTCTAGCAGCAGGGACAGGG - Exonic
1132621197 16:868970-868992 GTTGTGTGCCAGCAGGGACAAGG + Exonic
1132760668 16:1507206-1507228 GCTGGGCAGCAGCAGGGACAGGG - Intronic
1133393172 16:5425730-5425752 AGTGTGGACCAGCAGGTGCATGG - Intergenic
1134662057 16:15991700-15991722 GGTGAGGACCAGCAAGGTGAAGG - Intronic
1135960052 16:26987762-26987784 GATGTGGTCCACCAGGAACATGG + Intergenic
1135990055 16:27212988-27213010 GGTGTGAACCTGCTGGGAAATGG - Intronic
1136162014 16:28426277-28426299 GTTGTGGACCAGCCGTGACCTGG - Intergenic
1136200952 16:28688713-28688735 GTTGTGGACCAGCCGTGACCTGG + Intronic
1136217292 16:28802897-28802919 GTTGTGGACCAGCCGTGACCTGG + Intergenic
1136568207 16:31082248-31082270 GGAGAGGAGCAGCAGAGACAAGG - Intronic
1137762579 16:50952550-50952572 GCAGTGGAGCAGAAGGGACAAGG + Intergenic
1138495950 16:57409584-57409606 GCTGTGGTCCAGCAGAGAGATGG + Intronic
1141116770 16:81315553-81315575 GGTGGGAACCGGGAGGGACAAGG - Intronic
1141705252 16:85661265-85661287 GGTGTTGTCCATCAGGGACACGG - Exonic
1142680116 17:1542536-1542558 AGTGTTTACCGGCAGGGACAAGG + Intronic
1142850239 17:2701257-2701279 GCTGTGGACCTGCAGGGAGAGGG + Exonic
1143023152 17:3926995-3927017 GGTGAGGCCCGGCAGGGGCAAGG - Intronic
1143652338 17:8271269-8271291 GGTGGGGGTCAGCAAGGACAGGG - Intergenic
1144066347 17:11627897-11627919 GGTGTGTCCCAGCAGGAAAAAGG + Intronic
1144399936 17:14886521-14886543 GGTGGGGACCAATATGGACAGGG + Intergenic
1145760344 17:27422008-27422030 GGTGAGGTCAAGCTGGGACAGGG - Intergenic
1147056438 17:37838833-37838855 GGTGTGGATGGGCAGGCACATGG - Intergenic
1147375974 17:40022716-40022738 GATGTGGCCCAGCAGGACCAGGG + Exonic
1148460295 17:47835864-47835886 AATGTGGACCTGCAGGGGCATGG - Intronic
1148699347 17:49578543-49578565 GTGGTGGACCTCCAGGGACAGGG + Intronic
1148806548 17:50266807-50266829 GGTTTGGCCCAGCAGGCAGAGGG + Intergenic
1151201322 17:72469975-72469997 GGTGGGGCCAAGAAGGGACAGGG - Intergenic
1152430625 17:80246596-80246618 GGTGTCGAACAGCGGGGCCACGG - Exonic
1152626311 17:81389400-81389422 GGGGTGGACCTGGAGGGGCAGGG - Intergenic
1152805944 17:82356415-82356437 GGGGTGGACAAGCAGGGACAAGG - Intergenic
1152807201 17:82361800-82361822 TGTGGGGACCAGCAGGGGCAGGG - Intronic
1152889813 17:82874044-82874066 CGTGTGGACCGGCACGGGCATGG + Intronic
1155238092 18:23841566-23841588 GGTGTGGGACAAAAGGGACAAGG + Intronic
1155897298 18:31346232-31346254 GGTGAAGAGCAGCAGGCACATGG - Intronic
1156068566 18:33175775-33175797 GGTAGAGACCAGCAGAGACAGGG - Intronic
1157493699 18:48140777-48140799 GGTGGGGGCCAGGAAGGACAGGG - Intronic
1158299261 18:56033490-56033512 GATCTGAAGCAGCAGGGACACGG + Intergenic
1160387324 18:78504495-78504517 GGTGTCGACCAGCAGGAGGATGG + Intergenic
1160387334 18:78504546-78504568 GGTGTCGACCAGCAGGAGGATGG + Intergenic
1160387354 18:78504648-78504670 GGTGTCGACCAGCAGGAGGATGG + Intergenic
1160387407 18:78504900-78504922 GGTGTCGACCAGCAGGAGGATGG + Intergenic
1160387417 18:78504951-78504973 GGTGTCGACCAGCAGGAGGATGG + Intergenic
1160998703 19:1897713-1897735 GGTGTGGACCTTCTGGGAAAGGG + Intergenic
1161102958 19:2430370-2430392 GGTGTGGGCCAGCATGGGGATGG - Exonic
1162070917 19:8151612-8151634 GAGGTGGCCCAGCAGAGACAGGG + Intronic
1165503361 19:36207888-36207910 AGTGTGGATCAGCAGAGACAGGG - Intronic
1166088844 19:40495021-40495043 GGTGTGCAGCTGCAGGGATATGG - Intronic
1166129384 19:40736952-40736974 GGTGTGGAGGGGCAGGGTCATGG - Intronic
1166538987 19:43593369-43593391 TGTGGGGACAAGAAGGGACAGGG + Intronic
1166776738 19:45317699-45317721 GGTGTGGAGAAGCAGAGAGATGG - Intronic
1166837968 19:45678709-45678731 TGTGGGGAGCAGCAGGGACCAGG + Intronic
1166878759 19:45914227-45914249 GGGATGGACCAGGAGGGTCAGGG + Exonic
1167226995 19:48251805-48251827 GGTCTGGACCAGCATCAACATGG + Intronic
1167634456 19:50646373-50646395 CGTGAAGACCAGGAGGGACAGGG + Intronic
1167736696 19:51299002-51299024 GGTGGGGACCAGCAGTGCGATGG - Intergenic
1167982101 19:53284007-53284029 GGTGTGGACAGGCAGTGGCATGG - Intergenic
1167984045 19:53299966-53299988 GGTGTGGACAGGCAGTGGCATGG + Intergenic
1168206533 19:54854175-54854197 GGTCTGTACCAACAGAGACAGGG + Intronic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
926125638 2:10270147-10270169 GGTCTGGAAACGCAGGGACAGGG + Intergenic
926131105 2:10303560-10303582 TGCGCCGACCAGCAGGGACAGGG - Intronic
926726827 2:16005091-16005113 GGTGTGGAGCACCAGGGAAGGGG - Intergenic
927506427 2:23617986-23618008 GGTGTGGAGCAGCTGCGACTGGG + Intronic
928174429 2:29024338-29024360 GGTGAGGACCACCAGGGAGCGGG - Exonic
928193702 2:29197234-29197256 GGTGTAGGGCAGCAGGGACTGGG + Intronic
930719766 2:54627794-54627816 GGTGAGGGCCAGCGGGGCCAGGG - Intronic
931103744 2:59031607-59031629 TCTCTGGACCAGCAGGGACTTGG + Intergenic
931878399 2:66539879-66539901 GGAGTGGAGGAGCAGGGAAATGG + Intronic
932421491 2:71604037-71604059 GGTGTGGGTCAGCAGGGCCAGGG + Intronic
932667247 2:73707908-73707930 GCTCTGGACTAGCAGGGCCAGGG - Intergenic
933574785 2:84055142-84055164 AGTGAGGAGCAGCAGGGTCAGGG - Intergenic
933636439 2:84713548-84713570 GCTGTGGACCAGGAGGGAGATGG - Intronic
934665610 2:96167893-96167915 GGTGTGGACCATCAGGAAATGGG - Intergenic
935148681 2:100414219-100414241 AGAGTGGGCAAGCAGGGACAGGG + Intronic
936017516 2:108971009-108971031 GCTGTGGACCTGAGGGGACAGGG + Intronic
937299557 2:120830738-120830760 GGTGGGGACCAGGACGGGCAGGG - Intronic
937910259 2:127072198-127072220 GGTGAAGGCCAGCAGGGACCCGG + Intronic
937941118 2:127286797-127286819 GGTGTGGCCCAGCATGGAGTAGG + Exonic
938117021 2:128609025-128609047 GGTGTGGACCAGCTGGCAGCAGG + Intergenic
938375912 2:130806520-130806542 GGAGTTGATTAGCAGGGACATGG + Intergenic
940279464 2:151974709-151974731 GGTGTGGAGCAGCAGGTGGAGGG - Intronic
946334400 2:219027821-219027843 GGTGTGGTTCATCAGGCACAGGG + Exonic
946739745 2:222789974-222789996 GCAGTGGACCAGCAGGGGCCTGG + Intergenic
948279746 2:236737954-236737976 GATGAGGACTGGCAGGGACAAGG + Intergenic
948410828 2:237759269-237759291 GGCGTGGCCCACCAAGGACAGGG - Intronic
948954759 2:241279603-241279625 CGTGTGGATCAGCAGGGAGATGG + Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169207012 20:3746192-3746214 GGAGTGGGCCTGCAGGAACAGGG + Intronic
1169273379 20:4217295-4217317 GGAGAGGGCCAGCAGGGTCAGGG + Intergenic
1172791310 20:37507341-37507363 GGTGGGGTCCAGGAGGGATAAGG - Intronic
1172883474 20:38216538-38216560 AGTGTGGTCCAGCTGGGACAGGG - Intronic
1173175942 20:40765001-40765023 GGTGTGCCCCAGCAGGCACTAGG - Intergenic
1173225982 20:41162754-41162776 GGGGTGGAAGAGCAGGGGCAGGG - Intronic
1173581446 20:44149554-44149576 GGGATGGAGCAGCAGGGAAATGG - Intronic
1174007226 20:47420337-47420359 GCAGTGGAGCAGGAGGGACAGGG - Intergenic
1174133146 20:48359915-48359937 GGTGAGGAACAGCAGGGAGGTGG - Intergenic
1175249265 20:57598958-57598980 GGTGTGGACCTTCTGTGACAAGG - Intergenic
1175553395 20:59831345-59831367 TGTGTGCACAAGCAGGGACCAGG + Intronic
1176118203 20:63442359-63442381 GGGGTGTATCAGCAGGGAAAGGG + Intronic
1176180453 20:63747293-63747315 GCTGTGGACCTGCAGAGGCAGGG + Exonic
1177393776 21:20507990-20508012 GGTGAGGAGCAGCAAGGTCAGGG + Intergenic
1178389928 21:32189813-32189835 GGTGTGGAAGGGCAGTGACAGGG - Intergenic
1179396564 21:41045618-41045640 GCTGTGGGCCAGCAGGCAGAGGG + Intergenic
1180119436 21:45737014-45737036 GGTGAGGAGCTGCAGGGCCAAGG + Intronic
1181339346 22:22165817-22165839 TGGGAGGCCCAGCAGGGACAGGG - Intergenic
1181441155 22:22935806-22935828 GGTGTGGCCCAGGAGGAGCATGG + Intergenic
1181514925 22:23404911-23404933 GGTGTGGGCCAGCGCTGACAGGG + Intergenic
1182357820 22:29730166-29730188 GGGCTGGCCCAGCAGGTACATGG - Exonic
1182453622 22:30435681-30435703 GAAGTGCACCAGCAGGGGCAGGG - Intergenic
1184623337 22:45700511-45700533 GGTGGGTACCAGCTGGGAGAGGG + Intronic
1184790915 22:46699383-46699405 GCCGTAGCCCAGCAGGGACACGG + Exonic
950182755 3:10926856-10926878 TGTGAGGACCAGCAGGCAAAGGG - Intronic
953808233 3:46089941-46089963 TGTGTGGATCAGCAGTCACAAGG + Intergenic
961355750 3:126339045-126339067 AGGGTGGAGCAGCAGGGCCAAGG + Intergenic
961390131 3:126547655-126547677 GGTGTGGACCAGAGGGAACCTGG + Intronic
961697247 3:128713961-128713983 GTTGGGGACCAAGAGGGACAGGG + Intergenic
962877823 3:139549421-139549443 GTGGAGGACCTGCAGGGACAAGG - Intergenic
963784592 3:149521161-149521183 GGTGTGGTCCAGAATGGAAAAGG + Intronic
964743579 3:159990720-159990742 GGTGGGCAGCAGGAGGGACAAGG - Intronic
965209992 3:165772600-165772622 GTTGTGTACCATCTGGGACAGGG - Intergenic
968470846 4:781652-781674 GGTGGGGACCGGCAGGGCCTGGG + Intergenic
968511640 4:998209-998231 GGTGGGGACCAGCAGAGGCGGGG + Intronic
968602989 4:1519248-1519270 AGGGTGGACAAGCAGGCACAGGG + Intergenic
968657635 4:1785542-1785564 GGTGAGGACCAGCAGGTCCTGGG - Intergenic
968816604 4:2824769-2824791 GGTGTGGGCCTGCAGGCACCAGG + Intronic
969373938 4:6750798-6750820 GGTGAGGACCACCTGAGACAGGG + Intergenic
969497793 4:7535828-7535850 GGTGCAGATCAGCAGGGCCAGGG - Intronic
969516209 4:7649496-7649518 GGTGTGGCCCAGCTGGGCCATGG + Intronic
971251860 4:24979272-24979294 GGTGTACACCACCAGGAACAGGG + Intronic
972628948 4:40827076-40827098 GTCCTGGACCAGGAGGGACAGGG + Intronic
976591316 4:86852128-86852150 GGACTGGACCGGAAGGGACAGGG + Intergenic
977461017 4:97325314-97325336 TGTGTGTATCAGTAGGGACATGG - Intronic
978602331 4:110441880-110441902 ATTGAGGACCACCAGGGACATGG - Intronic
980716812 4:136638542-136638564 GGGGTGGACCTGGAGGAACAGGG - Intergenic
983929334 4:173435778-173435800 GGTCTGCACCAGCAGTGCCAGGG - Intergenic
985736963 5:1589001-1589023 GGAGTGGACTAGCAGAGACTGGG + Intergenic
986013864 5:3740696-3740718 CATGTGGACCTGCAGGGACGCGG - Intergenic
986254202 5:6088203-6088225 GGTCTGGACAAGCAGGCAGATGG - Intergenic
986338337 5:6770673-6770695 CCTGTGGACGAGCAGGGGCAGGG + Intergenic
988706239 5:33728480-33728502 GGTGAGGGCCACCAGGAACAGGG - Intronic
989289126 5:39741148-39741170 GGTCTGGATGAGCAGGGAGAAGG - Intergenic
993269341 5:85773801-85773823 GCTGTGGAGCAGCAGGCACTGGG - Intergenic
997034334 5:130170040-130170062 GTTGTGTACTAGTAGGGACAGGG + Intronic
997435292 5:133869715-133869737 GGTCAGGACCAGGAGGGACCTGG - Intergenic
998168885 5:139860420-139860442 TGTGGGGCACAGCAGGGACATGG - Intronic
998383547 5:141742753-141742775 GATGAGGCCCAGCAGGGACCTGG + Intergenic
999122449 5:149219634-149219656 GGTGTGCACAGGAAGGGACAGGG - Intronic
1002342669 5:178527139-178527161 GGTGTGGACAAGCAGGGCTCAGG + Intronic
1002493520 5:179596711-179596733 GGTGTGGCTCAGGAGGGACTGGG + Intronic
1002505904 5:179678982-179679004 GTTGTGGTCCAGCAGGTAGAAGG + Exonic
1002590713 5:180290283-180290305 GGTGTGAAGGAGCAGGGCCAAGG - Intronic
1002616256 5:180458258-180458280 GGGGTTGACCTGCAGGGGCAAGG - Intergenic
1005289636 6:24366604-24366626 GGTGTGGACATGCAGGAAGAAGG + Intergenic
1005825412 6:29628862-29628884 AGTGTAGCCAAGCAGGGACAAGG + Intronic
1007281266 6:40714002-40714024 TGTGTGGAGTAGCAGGGACAGGG + Intergenic
1007789751 6:44302225-44302247 GGTAGGGACCAGCAGGGCCAGGG + Intronic
1008036321 6:46749162-46749184 GGTGGTGACCAGCAGGGCCTGGG - Intronic
1008337210 6:50321984-50322006 GTTCTGTACCAGCAGGAACAGGG - Intergenic
1009324958 6:62338456-62338478 AGTGAGGAGTAGCAGGGACAAGG - Intergenic
1009946587 6:70347703-70347725 AGTGAGGAGAAGCAGGGACAGGG + Intergenic
1016488034 6:144565040-144565062 GTTGTGGTCCAACTGGGACATGG + Intronic
1016720367 6:147289119-147289141 GGTGTGGACCATCAGGAAATGGG + Intronic
1017329599 6:153180456-153180478 GGTAAGGACCTGCAAGGACAAGG - Intergenic
1018902648 6:168059075-168059097 GGGGTGGAGGAGCAGGGCCAGGG + Intronic
1019000377 6:168744405-168744427 GGGGTGGAGCAGCAGGGAGTGGG + Intergenic
1019156020 6:170039526-170039548 ACGGTGGGCCAGCAGGGACATGG - Intergenic
1019156101 6:170039826-170039848 ACGGTGCACCAGCAGGGACATGG - Intergenic
1019499261 7:1356182-1356204 GGTTTGGAGCAGGAGGGACATGG - Intergenic
1019544216 7:1565388-1565410 GCTGTGAACCCGCAGGGGCAGGG + Intergenic
1020256232 7:6504285-6504307 GGCGGGGCCCAGCAGGGAGAGGG + Intronic
1021477773 7:21081957-21081979 GGTGAAGACAAGAAGGGACATGG + Intergenic
1022013357 7:26328348-26328370 GGTGTGGATGGGCAGGGAGAAGG + Intronic
1023529152 7:41135691-41135713 TGTGTGGACAAGCAAGCACAGGG + Intergenic
1023615130 7:42012016-42012038 GGTGAGGACCAGCAGGAAGTCGG - Intronic
1023929740 7:44697975-44697997 AGTCTGCACCAGCAGGGACGGGG - Intronic
1024562537 7:50656491-50656513 TGTGTGGCCCTGCAGTGACAGGG - Intronic
1025622244 7:63184356-63184378 ATTGAGGACCACCAGGGACATGG - Intergenic
1026504355 7:70969643-70969665 GCTGTGGACAAGGAGGGCCAGGG + Intergenic
1029251483 7:99239824-99239846 AGTGTGGGCCAGCAGAGAGAAGG - Intergenic
1029642908 7:101832334-101832356 GTTGGGGAACAGCAGGGGCAGGG + Intronic
1029734397 7:102457568-102457590 GGTGAGGACCAGCAGGGAGCGGG + Exonic
1030886271 7:114941913-114941935 GGGGTTGAGCAGCAGGGAAAGGG - Intronic
1035701457 8:1641994-1642016 GGTGAGGACCAGCGGGGTCGAGG - Intronic
1035701495 8:1642118-1642140 GGTGAGGACCGGCAGGGTCGAGG - Intronic
1035891085 8:3344128-3344150 GGTTTTGACCAGCCGGGAGAGGG + Intronic
1036584719 8:10112969-10112991 GTTATGGACCAGCAGGGGTAAGG - Intronic
1036589299 8:10153404-10153426 CGGGTGGACCAGCAGGGAAAAGG - Intronic
1037865265 8:22438183-22438205 GGTGGGGACACGAAGGGACAGGG + Intergenic
1039198491 8:35059991-35060013 GTGGTCTACCAGCAGGGACAAGG + Intergenic
1040384014 8:46901031-46901053 AGTGTGGAGCAGCCGGGCCAGGG - Intergenic
1042676851 8:71330649-71330671 CATGTGGTCCAGCAGGGACAAGG + Intronic
1045009916 8:97950006-97950028 AGTGGGGAGCAGCAGGGAGAGGG + Intronic
1045056995 8:98377761-98377783 GGTGGTAATCAGCAGGGACATGG + Intergenic
1045322513 8:101092504-101092526 GGTGCGGAGCTGCATGGACAGGG + Intergenic
1046285894 8:112092485-112092507 AGTGAGGAGCAGCAGGGGCAGGG + Intergenic
1047384406 8:124395933-124395955 TGGGTGGACCAGGAGGGGCATGG - Intergenic
1048303154 8:133266055-133266077 GGTGAGGACATGGAGGGACATGG - Intronic
1048367646 8:133752600-133752622 GGTGTGGACCAGGCTGGTCAGGG - Intergenic
1048513684 8:135085706-135085728 TGTGTAGAACAGCAGGGACAGGG + Intergenic
1049351139 8:142165448-142165470 GGGGTGGGTCAGCAGGGACTGGG - Intergenic
1049366170 8:142237950-142237972 GGCGTGGGCCAGCAGGGAAACGG - Intronic
1049514098 8:143044428-143044450 GTTGTGGGTCTGCAGGGACAGGG - Intronic
1049578659 8:143400976-143400998 GGTGGGGACCTGCAAGGGCATGG + Intergenic
1051415903 9:16840172-16840194 GGTATGGACCAGAAGGCACAAGG - Intronic
1052352486 9:27471385-27471407 GGTGTAGACCAGTAGGGGCAGGG - Intronic
1052983908 9:34471416-34471438 GTTGGGGACCAGGAGAGACAGGG - Intronic
1053113235 9:35480241-35480263 GGTCTGCACCACCAGGGAGAAGG - Intergenic
1053543342 9:38997430-38997452 TGTCTGGAGCATCAGGGACAGGG + Intergenic
1053807776 9:41820938-41820960 TGTCTGGAGCATCAGGGACAGGG + Intergenic
1054622816 9:67366490-67366512 TGTCTGGAGCATCAGGGACAGGG - Intergenic
1057830356 9:98401542-98401564 GTTGTGGACAAGCAGGAACCAGG - Intronic
1059290812 9:113221923-113221945 CTTCTGGACCAGCAGGCACATGG - Intronic
1059792387 9:117654164-117654186 GGACTGGACCAGAAAGGACATGG - Intergenic
1061206489 9:129166909-129166931 ACTGTGGACCACCAGGCACAAGG - Intergenic
1061548557 9:131318931-131318953 TGTGTGTACCAGGAGGGTCAGGG - Intergenic
1062157450 9:135060956-135060978 GTGCTGGACCAGCAGGGAAAGGG - Intergenic
1062208090 9:135348286-135348308 GGTGAGGACCAGCCGGGGCCAGG - Intergenic
1062395647 9:136351592-136351614 GGTCTGGGCCAGCAGGGCAAGGG + Intronic
1062440886 9:136568776-136568798 GGTGAGGGGCCGCAGGGACATGG - Intergenic
1062631250 9:137464130-137464152 GGTGTGGACCCGCATGGCCGAGG + Exonic
1185623240 X:1466076-1466098 GGTGCGCGCCAGCGGGGACAGGG + Exonic
1188046700 X:25433312-25433334 GGAGTGGAGCTGCAGGGTCAGGG + Intergenic
1189414718 X:40803791-40803813 GGGGTGGACCCGGAGGAACAGGG + Intergenic
1190003583 X:46712750-46712772 GGTGTCTAGCAGTAGGGACATGG - Intronic
1190495566 X:51025512-51025534 GGGGTGGACCGGAAGGGAGAGGG + Intergenic
1190687467 X:52887777-52887799 GGTGTGGACAAGCAGTCCCAAGG + Intergenic
1190698515 X:52968015-52968037 GGTGTGGACAAGCAGTCCCAAGG - Intronic
1191182432 X:57577852-57577874 GGTATGGATCACCAGGGATAGGG + Intergenic
1191215154 X:57925819-57925841 GGTGTGGATTACCAGGGATAGGG - Intergenic
1192184866 X:68940191-68940213 GGTGAGGACAACCAGGGAGAAGG - Intergenic
1192193776 X:69015356-69015378 GCTGTGGAACACCAGGGAGAAGG + Intergenic
1192450896 X:71244259-71244281 GGTGTGGGGAGGCAGGGACAGGG - Intronic
1193472643 X:81925826-81925848 GGTGTGGCCAGGCAGGGGCATGG - Intergenic
1195773131 X:108373579-108373601 GGGGTGGAGTAACAGGGACAGGG - Intronic
1199399167 X:147376729-147376751 AGTGAGGAACAGCAGGGGCAAGG + Intergenic
1200184818 X:154175426-154175448 GGTGTGGGACTGCAGGGAGAGGG + Intergenic
1200190471 X:154212564-154212586 GGTGTGGGACTGCAGGGAGAGGG + Intergenic
1200196222 X:154250366-154250388 GGTGTGGGACTGCAGGGAGAGGG + Intergenic
1200201877 X:154287484-154287506 GGTGTGGGACTGCAGGGAGAGGG + Intronic