ID: 1125759698

View in Genome Browser
Species Human (GRCh38)
Location 15:42088210-42088232
Sequence CTCAGCTATCTGCACTGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125759694_1125759698 -3 Left 1125759694 15:42088190-42088212 CCACAGGCGCTACCCTGGATCTC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1125759698 15:42088210-42088232 CTCAGCTATCTGCACTGTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 126
1125759692_1125759698 2 Left 1125759692 15:42088185-42088207 CCAGTCCACAGGCGCTACCCTGG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1125759698 15:42088210-42088232 CTCAGCTATCTGCACTGTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 126
1125759691_1125759698 3 Left 1125759691 15:42088184-42088206 CCCAGTCCACAGGCGCTACCCTG 0: 1
1: 1
2: 19
3: 17
4: 118
Right 1125759698 15:42088210-42088232 CTCAGCTATCTGCACTGTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 126
1125759690_1125759698 12 Left 1125759690 15:42088175-42088197 CCTCAGCAGCCCAGTCCACAGGC 0: 2
1: 0
2: 4
3: 57
4: 640
Right 1125759698 15:42088210-42088232 CTCAGCTATCTGCACTGTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125759698 Original CRISPR CTCAGCTATCTGCACTGTAA GGG Intronic
904365426 1:30008043-30008065 CTCAGCGTTCTGCACTGGACAGG - Intergenic
906384446 1:45355331-45355353 CTCAGCTACCTTCACTTCAAAGG - Exonic
906838342 1:49108615-49108637 CTCATCTCTTTGCACTGTCAGGG + Intronic
908477058 1:64499618-64499640 CTCTGTTGTCTGCAATGTAATGG - Intronic
909208985 1:72798544-72798566 CTCACCTAACTGAACTGTACAGG - Intergenic
909210499 1:72816888-72816910 CTCAGCTTGCTGCACTATCATGG + Intergenic
914941436 1:152026714-152026736 CTCAGCTTTCTGCAGTGTGCTGG + Intergenic
918163073 1:181919355-181919377 CTCAGCTCTCTGGTCTGTGAAGG + Intergenic
920554299 1:206893140-206893162 CTCAGCTTTCTAGTCTGTAAAGG + Intergenic
921992254 1:221380003-221380025 CTCAGCTTTCTGGCCTCTAAAGG - Intergenic
922003389 1:221503801-221503823 CTCAGCTGTAGGCACTGGAATGG + Intergenic
1070230055 10:74556361-74556383 ATAAGCTATCTGCACTGAGAAGG - Intronic
1071088306 10:81890013-81890035 CTCAGCCATTTGCAGTGTATTGG - Intronic
1072072204 10:91929311-91929333 CTCAGCGATCTGTGCTGTAAAGG + Intronic
1074959553 10:118429058-118429080 TTCAGCGTTCTGCACTGTTACGG - Intergenic
1075809259 10:125212759-125212781 CACAGCTGTCTGCTCTGTACTGG + Intergenic
1075875122 10:125799734-125799756 CTCAGCTGACTTCACTGAAAAGG + Intronic
1080663506 11:34315882-34315904 CTCAGGTTTCTCCACTGTGAGGG - Intronic
1081484572 11:43517634-43517656 GTCACCTCACTGCACTGTAATGG - Intergenic
1083638641 11:64133634-64133656 CTCAGCTTGCTGCACTGGGAAGG - Intronic
1091345463 11:134850152-134850174 TTCAGCTAACTTCTCTGTAAAGG - Intergenic
1095341972 12:41100714-41100736 CTCTGCTATCTGCAGAGTGAAGG - Intergenic
1095985870 12:47999277-47999299 CCCATGTATCTGCACTGTAGTGG - Intronic
1103631063 12:122261434-122261456 CTCGTCTATCTTCACTGCAAAGG + Exonic
1106185044 13:27402040-27402062 TTAAGCAATCTGCAATGTAATGG - Intergenic
1106302347 13:28480337-28480359 CTAAGCTATAAACACTGTAAAGG - Intronic
1108108546 13:47041497-47041519 CTCAGCTTTCTCATCTGTAAGGG - Intergenic
1110822440 13:79932541-79932563 CAAAGCTATCTGTACTATAAGGG - Intergenic
1117809262 14:59529390-59529412 CTCAGCTAACTGCACAAGAAGGG + Intronic
1118707482 14:68493605-68493627 GTCAGCTATTTACACTGTATGGG + Intronic
1119736189 14:76984280-76984302 CTCAGCCTTCTGCACAGTCAAGG - Intergenic
1121951361 14:98173566-98173588 CTCTGATCTTTGCACTGTAAAGG + Intergenic
1123847302 15:24315521-24315543 CTCAGCCAACTGCACGGTGAAGG + Intergenic
1124119137 15:26873961-26873983 CTCAGTTATCTGCTTTATAAAGG + Intronic
1125617652 15:41029978-41030000 CTCAGCCATCTGCCCAGGAATGG - Intronic
1125690003 15:41588299-41588321 CTTAGCTATCTGCAGTTTGAGGG + Intergenic
1125759698 15:42088210-42088232 CTCAGCTATCTGCACTGTAAGGG + Intronic
1131508720 15:93037216-93037238 CTCAGCTATCTCAGCTGTGAGGG - Intronic
1135265420 16:21021519-21021541 CTCTACTATCTGCACTCCAAAGG + Intronic
1136143240 16:28300643-28300665 CTCAGTTTCCTGAACTGTAAAGG + Intronic
1137775503 16:51050889-51050911 CTCAGCTTTCCCCTCTGTAAAGG + Intergenic
1137816820 16:51405991-51406013 ATCAGCTATCAGTACTGTTAGGG + Intergenic
1137894376 16:52195196-52195218 TTCATCTATCTCCACTCTAATGG + Intergenic
1138934148 16:61697993-61698015 TCAAGCTATCTGCACTGTAAAGG - Intronic
1140511946 16:75515185-75515207 GTCAGCTCTCTCCATTGTAAGGG - Intergenic
1141392236 16:83674557-83674579 CTCTGCCTTATGCACTGTAAAGG - Intronic
1146187087 17:30731255-30731277 CTCAGCTTTCTGAGCTGAAAAGG + Intergenic
1146332122 17:31936615-31936637 CTCAGCTTTCTGAGCTGAAAAGG + Intergenic
1147302621 17:39541884-39541906 CTCAGTTTCCTGCTCTGTAAAGG - Intronic
1151020315 17:70608769-70608791 CTCATTTTTCTCCACTGTAAAGG - Intergenic
1159468542 18:68818145-68818167 GTCAGCTAGCTACACTGGAAAGG - Intronic
1159653399 18:71003805-71003827 CTCAGCTCCCTGCACTGTTCTGG + Intergenic
1159995886 18:74963552-74963574 CTCAGTTTTCTGCATTGTAGTGG + Intronic
1162528478 19:11221659-11221681 CTCAGGTTTCTCCCCTGTAATGG - Intronic
1164628365 19:29744660-29744682 CTCAGCTATGTGCACAGGAAGGG + Intergenic
1166075141 19:40409885-40409907 CTCAGGTGTCTCCTCTGTAATGG - Intronic
925810509 2:7695408-7695430 CTGAGATATCTGAACTGGAAGGG - Intergenic
926818066 2:16820550-16820572 CTCAGCTGTCTTCACTGTGTTGG + Intergenic
927502841 2:23593753-23593775 CTGAGATATCTAAACTGTAAGGG - Intronic
927841328 2:26446458-26446480 CTCAGCTCTGTCCACTGAAAAGG - Intronic
928302360 2:30137161-30137183 CACAGCTATCTGCACACAAAAGG - Intergenic
928499903 2:31880034-31880056 CTCAGCTCTCTATATTGTAATGG + Intronic
928875833 2:36038072-36038094 CTCAGGTTTCTGCACTGCAAAGG + Intergenic
929270752 2:39969156-39969178 CTTAGGAATCTGCATTGTAATGG + Intergenic
929425154 2:41837244-41837266 CTCAGGAATCTGCAGTGTAATGG - Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
933298605 2:80518048-80518070 TCCAGCTATCTGCAGTCTAATGG - Intronic
933594635 2:84270759-84270781 TTCAGCTATCTGCATTTTATAGG - Intergenic
937059073 2:118968028-118968050 CCCAGCTCTCTCCTCTGTAAAGG + Intronic
937136465 2:119557981-119558003 ATCAGCAATCTGCACTCTAGGGG - Intronic
939789896 2:146559322-146559344 CTCAACTATCTGCAATCTAAGGG - Intergenic
940807166 2:158200734-158200756 GTCAGCTCTCTCCATTGTAAAGG + Intronic
942349330 2:175036532-175036554 CTTGGCTATCTACACTGTACTGG + Intergenic
946845958 2:223859300-223859322 CTCAACTTCCTGCACTGAAAGGG + Intronic
947752359 2:232539720-232539742 CTCAGCTCTCTGCAGTGACAGGG - Exonic
947759378 2:232592660-232592682 CTCAGCCACCAGCACGGTAAAGG - Intergenic
1169184108 20:3598292-3598314 CTCTGCTATCTGCCCTCTGATGG - Intronic
1171008620 20:21493166-21493188 CTCAGCACTCTTCACTATAAAGG + Intergenic
1171505444 20:25629418-25629440 CACAGCTGTCTGCTCTGTACTGG + Intergenic
1171989349 20:31684047-31684069 CTCAAATATCTCCTCTGTAAAGG - Intronic
1173602693 20:44307304-44307326 CTCAGGTCTCTACACTGTCAGGG + Intronic
1174754163 20:53141605-53141627 CTCAGCTGTCAGGGCTGTAATGG + Intronic
1178528452 21:33353568-33353590 CACAGCTGTCAGCACTGTTAAGG + Intronic
1179726361 21:43343560-43343582 TTCAGCTATCTGCATGGAAAAGG - Intergenic
1181483356 22:23215357-23215379 CTCAGCCATCTGCTCATTAATGG + Intronic
1181865992 22:25855753-25855775 TTCAGCTATATGCCCAGTAATGG + Intronic
1184959859 22:47921194-47921216 CTCAGCTACATGCACTGTGGGGG - Intergenic
1185127644 22:49020517-49020539 CTCAGCACTTTGCACTGCAATGG + Intergenic
952774224 3:37029218-37029240 CTTAGCTAACAGCAGTGTAATGG + Intronic
953039955 3:39247226-39247248 GTCAGATCTCTCCACTGTAAAGG - Intergenic
954156860 3:48690145-48690167 CTCAGCTGTGTGCACTAAAAAGG + Intronic
955837516 3:63072918-63072940 CTCAGCTGTCTACACTGCAGTGG - Intergenic
960877777 3:122314340-122314362 CTCAGGAATCTGCACTGAACAGG + Intergenic
961089881 3:124101769-124101791 CTCAGCTATCTGCACAGCTCTGG + Intronic
962936636 3:140087446-140087468 CTCAGCATTCTGCATTGGAAGGG + Intronic
967251172 3:187540789-187540811 GTCAGATTTCTCCACTGTAAAGG - Intergenic
968527326 4:1067925-1067947 CTCAGCAATTTTCACTGTACAGG - Intronic
969885143 4:10208780-10208802 CTCACCTGTCTGCTCTGTAAAGG - Intergenic
971066151 4:23035525-23035547 CTCAGATCTCTGCACAGTAAGGG + Intergenic
971771065 4:30897928-30897950 ATCAGCTCTCTGCCTTGTAATGG + Intronic
972290786 4:37687836-37687858 CTCAGCCATCTGTACTGTAGTGG - Intergenic
975048279 4:69829535-69829557 CTCAGCTTTCAGGACAGTAAGGG + Intronic
978971140 4:114807622-114807644 CACAGCTGTCTGCTCTGGAATGG + Intergenic
984865354 4:184275937-184275959 TTCAGGTATCTGCAGTGTACAGG + Intergenic
985989513 5:3543855-3543877 CACTGCTAACTGCACTGTCAGGG + Intergenic
990396862 5:55391115-55391137 CTAAGCTAGGTGCACTCTAAAGG - Intronic
997301805 5:132811865-132811887 CTCAGCTTTCTTGTCTGTAAAGG - Intergenic
1001964663 5:175901813-175901835 CTCAGCTATCCGCACCTTCAAGG + Intergenic
1009244323 6:61216824-61216846 GCCAGCTTTCTCCACTGTAAAGG + Intergenic
1010683137 6:78819773-78819795 CTCAGGCATCTGCAATCTAATGG + Intergenic
1010836546 6:80594818-80594840 CACAGCTATCCGCACTGCACAGG - Intergenic
1012676089 6:102114980-102115002 CTCAGATCTCTGCACAGGAAGGG + Intergenic
1015382483 6:132585673-132585695 CTCATCTGTGTGCCCTGTAAGGG + Intergenic
1016324140 6:142880393-142880415 CTCAGCTGTCTCCACTGGGAGGG - Intronic
1017610695 6:156183365-156183387 CTCAGCCATATGCTCTGTCATGG + Intergenic
1018294598 6:162332055-162332077 CTCTGCCATCTGCTCTTTAAAGG + Intronic
1022373728 7:29793720-29793742 CTCTGTTATCTACACTTTAAAGG - Intergenic
1022576279 7:31500101-31500123 CTCAGGTATATGCACTGGACTGG + Intergenic
1023290691 7:38665845-38665867 CTCAGCTATATACACAGCAATGG - Intergenic
1028546133 7:92003882-92003904 TTCTGCTATCTACAATGTAATGG + Intronic
1031588950 7:123566518-123566540 TTCAGCAATCTGAACTGGAAAGG - Intergenic
1031607449 7:123786756-123786778 TTCATCTATCTAAACTGTAAAGG + Intergenic
1031649225 7:124265428-124265450 GTCAGTTTTCTTCACTGTAATGG - Intergenic
1031657418 7:124374961-124374983 CTAAGCTATCTGCATTTGAAGGG - Intergenic
1032124813 7:129185777-129185799 CTCTGCTATCTCCAATGTGAAGG + Intergenic
1037404663 8:18528852-18528874 CTTAGCTCTCTGCCCTGCAAAGG + Exonic
1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG + Intronic
1043308914 8:78833720-78833742 CTGAGCTTTCTGCAATGTCATGG - Intergenic
1056315843 9:85389046-85389068 CTCAGCTACCTGCATGGAAATGG - Intergenic
1185770202 X:2760109-2760131 CTCAGCTCACTGCAGTGCAATGG - Intronic
1186907471 X:14127131-14127153 CTCAGCTTCCTACAATGTAAAGG - Intergenic
1190275298 X:48895488-48895510 GACAGCAATCTGCACTGTAGAGG + Exonic
1190715085 X:53096446-53096468 CTCAGCCCTCTGCAGTGTACAGG - Intergenic
1197005148 X:121487496-121487518 CTCAGCTTTCTTTACTGCAAGGG + Intergenic
1198201538 X:134424312-134424334 ACCAGCTATCTCCATTGTAAAGG - Intronic
1201300011 Y:12497282-12497304 CTCAGCTCACTGCAGTGCAATGG + Intergenic