ID: 1125760840

View in Genome Browser
Species Human (GRCh38)
Location 15:42094486-42094508
Sequence CCCAGCCCTTGCCAAGATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 264}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125760832_1125760840 23 Left 1125760832 15:42094440-42094462 CCAGGTGACAGGCTCTCCATGCT 0: 1
1: 0
2: 1
3: 18
4: 156
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264
1125760830_1125760840 25 Left 1125760830 15:42094438-42094460 CCCCAGGTGACAGGCTCTCCATG 0: 1
1: 0
2: 1
3: 16
4: 265
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264
1125760833_1125760840 7 Left 1125760833 15:42094456-42094478 CCATGCTAGCCCTTCCAGCTTCA 0: 1
1: 0
2: 0
3: 41
4: 315
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264
1125760837_1125760840 -7 Left 1125760837 15:42094470-42094492 CCAGCTTCACTCCAGGCCCAGCC 0: 1
1: 0
2: 7
3: 68
4: 565
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264
1125760831_1125760840 24 Left 1125760831 15:42094439-42094461 CCCAGGTGACAGGCTCTCCATGC 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264
1125760836_1125760840 -3 Left 1125760836 15:42094466-42094488 CCTTCCAGCTTCACTCCAGGCCC 0: 1
1: 0
2: 7
3: 56
4: 512
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264
1125760835_1125760840 -2 Left 1125760835 15:42094465-42094487 CCCTTCCAGCTTCACTCCAGGCC 0: 1
1: 0
2: 1
3: 33
4: 337
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264
1125760829_1125760840 26 Left 1125760829 15:42094437-42094459 CCCCCAGGTGACAGGCTCTCCAT 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG 0: 1
1: 0
2: 3
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125760840 Original CRISPR CCCAGCCCTTGCCAAGATGC TGG Exonic
900558554 1:3292100-3292122 CACAGGCCTTGGCAGGATGCTGG + Intronic
900974838 1:6010633-6010655 CTCAGCCCTTGACAACATGGAGG - Intronic
901684230 1:10934838-10934860 CCCAACCCCTGCCAAGTTGTGGG + Intergenic
902670087 1:17967087-17967109 CCCAGCCCTGAACCAGATGCTGG - Intergenic
903257854 1:22114673-22114695 CCCAGCCCTTGTCAGCATCCCGG - Intergenic
903275165 1:22216935-22216957 CCCTGCCCTTGCAGAGATGGGGG - Intergenic
903665162 1:25001615-25001637 CCCAGCCCAATCCAGGATGCTGG - Intergenic
903768360 1:25749004-25749026 CCCAGCCCTTGCTGAGATGATGG - Intronic
904199520 1:28810953-28810975 CCCAGCCCTCTCCTGGATGCAGG + Intergenic
904484541 1:30816178-30816200 CCCTGCCCCTGCCAAGGTGGAGG + Intergenic
905883541 1:41479586-41479608 TACAGCCCTTGCCCAGATCCTGG + Intronic
905914729 1:41676748-41676770 CCCTGCCCTGGCCAGGATGGTGG - Intronic
907943099 1:59107790-59107812 CCCAGCCTCCGCCCAGATGCTGG + Intergenic
913253970 1:116937708-116937730 CCTATCCCTTGTCAAGAAGCTGG - Intronic
915390988 1:155543815-155543837 CTCAGCCCCTGCCAAGTAGCTGG - Intronic
915554962 1:156656293-156656315 CCCAGCCCCTGCCACAATGGTGG + Exonic
915917435 1:159949414-159949436 CCCAGTGCTTGCCAAGTTCCTGG + Intergenic
917791660 1:178503012-178503034 CCCAGGCCATGCCCCGATGCAGG - Intergenic
918233569 1:182557552-182557574 CCCATCTATTGCCAACATGCAGG - Intronic
920505210 1:206510869-206510891 CCCAGCCCTTGGAAACAAGCAGG + Intronic
920609454 1:207423114-207423136 AGCAGCCAATGCCAAGATGCAGG + Intergenic
921260145 1:213379019-213379041 CCCAACCCTTGCCGAGAACCTGG - Intergenic
921484238 1:215697329-215697351 ACCAGCCTTTGCCAAGAGGAGGG - Intronic
921895064 1:220391200-220391222 CCCAGCCTTTGCCAGTATTCTGG - Intergenic
922204841 1:223437187-223437209 CCCACCCCTTCCCAGGAGGCTGG + Intergenic
923743554 1:236678783-236678805 CCCAGGCCTTCCCAATTTGCAGG + Intergenic
924772420 1:247089134-247089156 CGCAGCCCTCCCCAGGATGCTGG - Intergenic
1062767436 10:76316-76338 CCCAGCACAGGACAAGATGCCGG - Intergenic
1065976427 10:30846595-30846617 CCCTGCCCTTTCCAAGTTGACGG + Intronic
1067083696 10:43227370-43227392 TCCAGGCCTGGCCAGGATGCAGG - Intronic
1069820377 10:71223908-71223930 CCCAGCTCCTGCTAAGAAGCTGG - Intronic
1072625670 10:97109807-97109829 CTCAGTCCCTGCCAAGCTGCTGG + Intronic
1073131980 10:101195524-101195546 CGCAGCCATTGCCAAGAGGCAGG - Intergenic
1076686106 10:132199126-132199148 TCCAGCCCCTGCCCCGATGCAGG - Intronic
1076771929 10:132670519-132670541 CACAGCCCTGGCCCAGAAGCAGG + Intronic
1077099577 11:816144-816166 CCCAGCCCTTGCCAGGATTCTGG + Intergenic
1077130362 11:969003-969025 CCCAGCCCTTCACAAGAAGGGGG + Intronic
1077158983 11:1104075-1104097 CCCAGCTCTTGCAAAGAGGAAGG + Intergenic
1080654455 11:34247662-34247684 CCCAGCCAGGGCCAAAATGCAGG + Intronic
1081438036 11:43049747-43049769 CCCAGCACTTCCAGAGATGCTGG + Intergenic
1081623671 11:44634232-44634254 CCCAGCCTTGGGCCAGATGCTGG - Intergenic
1082122741 11:48397002-48397024 CCCAGTGGTTGCCAAGCTGCTGG - Intergenic
1082251888 11:49991672-49991694 CCCAGTGGTTGCCAAGCTGCTGG + Intergenic
1082556444 11:54568283-54568305 CCCAGTGGTTGCCAAGCTGCTGG - Intergenic
1082816692 11:57514261-57514283 CCCAGCCGGTGCCAAGGAGCTGG + Intronic
1084456339 11:69270119-69270141 CCCAGACCTTGTCAATCTGCCGG - Intergenic
1084512376 11:69614245-69614267 CCCAGCCCACGGCAGGATGCAGG + Intergenic
1084669258 11:70595682-70595704 GCCAGCCCTTCCCCAGCTGCTGG + Intronic
1089524175 11:119085772-119085794 CCCAGCCCTCACCAACAGGCTGG - Intronic
1091237011 11:134028877-134028899 CACAGCCCTTGCCAGGATCATGG + Intergenic
1091585005 12:1811097-1811119 CCCTGCCCTTGCCCAGAGTCAGG + Intronic
1092132505 12:6122644-6122666 CCCTTCCCTTGCTAAGATTCTGG - Intronic
1092526480 12:9312942-9312964 CCCTGTCCTGGCCAAGCTGCCGG + Intergenic
1092540796 12:9418840-9418862 CCCTGTCCTGGCCAAGCTGCCGG - Intergenic
1093317156 12:17666254-17666276 CCCAACCCTCGCCATGCTGCAGG - Intergenic
1094512252 12:31103644-31103666 CCCTGTCCTGGCCAAGCTGCCGG + Exonic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1102238491 12:111309384-111309406 CCCACCCCAGGCCAAGGTGCTGG + Intronic
1102441569 12:112967672-112967694 CCCAGCCCTGGCCAAGATCCTGG + Intronic
1103268159 12:119648347-119648369 CCAAGCCCTAGTCTAGATGCTGG - Intergenic
1103935268 12:124472848-124472870 CCAAGCCCTTCCCAAGTTCCTGG - Intronic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1105003609 12:132707274-132707296 CCCACCCCCTGCCATGATGGAGG + Intergenic
1106458798 13:29950144-29950166 CCCAGCTCTTGCCTACATTCTGG - Intergenic
1106614148 13:31310830-31310852 CCCACCCCTTGTCCAGATGCTGG + Intronic
1107490443 13:40876177-40876199 GTCAGCCCTTGCCAAAATACTGG - Intergenic
1107668379 13:42716551-42716573 CTCAGCCCTTCCCAATGTGCTGG + Intergenic
1112211803 13:97385182-97385204 CCCAGCCCTATCCTAGATACTGG + Intronic
1112362105 13:98727665-98727687 CTCAGCTCTTGCCAAAATTCCGG - Intronic
1115785944 14:36826307-36826329 CCCAAGCCTTGCCAAGCTGGAGG - Intronic
1118607387 14:67514352-67514374 CCCTGCCCTTGCCAGGAACCGGG + Intronic
1118879374 14:69813222-69813244 CTCAGAGCTTGTCAAGATGCAGG + Intergenic
1119407864 14:74409908-74409930 CTCTGCCCTTTGCAAGATGCAGG + Intronic
1121454543 14:94029931-94029953 CTCTGCCTTTCCCAAGATGCAGG - Intronic
1121812342 14:96902200-96902222 CACAGGCATTGCCAGGATGCTGG - Intronic
1122075030 14:99230486-99230508 GCCAGGCCCTGCCGAGATGCCGG + Intronic
1122214626 14:100194654-100194676 CCCAGCCCTTGGCCTGATGCTGG - Intergenic
1122346872 14:101066298-101066320 CCCACCCCTCGCCAGGATGTTGG + Intergenic
1122849878 14:104522420-104522442 ACCACGCCTTGCCAGGATGCTGG + Intronic
1123947722 15:25246921-25246943 CCCAGGCCGTGCCATGCTGCAGG - Intergenic
1124159407 15:27255055-27255077 CCCAGCCCCTGCAAAGATCCTGG + Intronic
1125725554 15:41866563-41866585 CCCAGCCATTCCCAGGAGGCTGG + Intronic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1127768309 15:62209410-62209432 CCCAGAACTTGCTAAGCTGCAGG + Intergenic
1127957095 15:63863048-63863070 CCAGCTCCTTGCCAAGATGCTGG - Intergenic
1128129772 15:65218607-65218629 TTCAGCTCTGGCCAAGATGCTGG + Intergenic
1129545568 15:76391424-76391446 CCCAGACCTTGTCAAGGTACTGG - Intronic
1130943308 15:88530061-88530083 CCCTGACCTTGCCCACATGCTGG - Intronic
1131050684 15:89345982-89346004 CCCAGCCCTTGACATGAGTCTGG + Intergenic
1131818220 15:96245051-96245073 CCCAGACCTTGAAAAGAGGCTGG + Intergenic
1132455993 16:23217-23239 CCCAGTGCAGGCCAAGATGCAGG + Intergenic
1132501260 16:285750-285772 CCCACCCCCTGCCAAGCTGGTGG - Intronic
1132852279 16:2030195-2030217 CCCAGGCCTTCCCAGCATGCAGG - Intronic
1132900571 16:2251752-2251774 GCCAGCCCTGGCCCAGATCCAGG - Intronic
1136338605 16:29627632-29627654 CCTGGCCCTTTCCAAGGTGCGGG + Intergenic
1137088977 16:36164581-36164603 CCTAGCCCTTGACAAGCTCCTGG + Intergenic
1137513849 16:49125397-49125419 CACAGTCCTTCCCAAGATGTAGG + Intergenic
1137686488 16:50390445-50390467 CCCAGGCCTTGCCCAGCTGGGGG + Intergenic
1138528767 16:57623600-57623622 GCCTGGCCTAGCCAAGATGCGGG - Intronic
1139229228 16:65266680-65266702 CCTTGCCCTTCCCAAAATGCTGG - Intergenic
1139369642 16:66458860-66458882 CCCAGCCCTGGACTAGAAGCTGG + Intronic
1140864750 16:79050268-79050290 CCCAGCTGATGCAAAGATGCAGG - Intronic
1142439027 16:90082451-90082473 CCCAGCGCAGGCCAAGATGCAGG + Intronic
1143775483 17:9196130-9196152 CCCAGGCCCTGCCCAGCTGCTGG - Intronic
1145916790 17:28578800-28578822 CACAGCCCTTGCCAGGAGGTAGG + Intronic
1146132817 17:30292867-30292889 CTCAGCCCTTAGTAAGATGCTGG + Intergenic
1146256344 17:31393097-31393119 CCCGGCCCATGCCCAGGTGCGGG - Intronic
1147740807 17:42670130-42670152 CCCGGGCCTGGCCAAGAGGCGGG - Exonic
1147905656 17:43820991-43821013 GCCATCCCTTGCCAGGAGGCGGG - Exonic
1147973714 17:44235597-44235619 CTCAGCCCCTCCCAAGGTGCTGG + Intergenic
1148086608 17:44997518-44997540 CCCAGCCCTTCCTAACTTGCAGG + Intergenic
1148131558 17:45265317-45265339 CCCAGCCCCTGCCAGGACCCTGG - Intronic
1150618332 17:66789421-66789443 CCCAGGCCCTGCCTAGTTGCTGG - Intronic
1150691322 17:67369610-67369632 CCCAGCACTTTCGAAGAGGCAGG - Intergenic
1151342931 17:73483190-73483212 CCCAGGCCTTGCCTTGATGCAGG + Intronic
1151766830 17:76137250-76137272 CCCAGCCCCTGCCTAGGTGGTGG + Exonic
1152605317 17:81286636-81286658 CCCAGCCCCTGCCAGGCTGGAGG + Intronic
1152624203 17:81380810-81380832 CCGACCCCATGCCAAGGTGCTGG + Intergenic
1152960270 18:75662-75684 CCCAGCACAGGACAAGATGCCGG - Intergenic
1153326147 18:3822396-3822418 CCCAGCCCCTGCTATGGTGCTGG - Intronic
1154065721 18:11105143-11105165 CCCAGGCCTTGCCATGATGGAGG + Intronic
1154201008 18:12300848-12300870 CCCAGGCCTGGCCCAGATGTCGG - Intergenic
1154497155 18:14970284-14970306 CCCTACCCTAGCCAAGCTGCAGG + Intergenic
1156456466 18:37297438-37297460 CAGAGCCCTTGACAAGGTGCGGG + Intronic
1156872167 18:41958237-41958259 GCAAGACCTTGTCAAGATGCAGG + Intronic
1157539066 18:48486402-48486424 GCCAGCCCTGGCCATGATGGAGG + Intergenic
1160737077 19:667781-667803 CCCAACCCCTGCCAGGATGAGGG - Intergenic
1160886101 19:1349054-1349076 CCTTGCCCTTCCCAAAATGCTGG + Intergenic
1161793914 19:6375783-6375805 CCCAGCCCTGTCCCAGCTGCAGG + Exonic
1162025248 19:7890138-7890160 CACAGCCCATGCTAAGAGGCAGG - Intronic
1162812374 19:13172150-13172172 CCAATCCCTTCCCAAGATTCTGG - Intergenic
1163641769 19:18466196-18466218 CTCAGCACCTGCCCAGATGCAGG + Intronic
1163726986 19:18928497-18928519 CTGAGCCCTGGCCAAGATTCAGG + Exonic
1165256066 19:34577820-34577842 CCCAGCCCCTCCCATGGTGCTGG + Intergenic
925259922 2:2520276-2520298 CCCAGCCCTGGCCAAGTAGAGGG - Intergenic
929991702 2:46795493-46795515 CCCAGCCAATGCCAAAATTCAGG + Intergenic
930971293 2:57398100-57398122 CCCCGCCCCTGCCAAGTTGGAGG - Intergenic
931791312 2:65666566-65666588 CCCAGCCCCTGCAGAGATACTGG - Intergenic
934502750 2:94872607-94872629 CTCAGTCCTGGCCCAGATGCTGG + Intronic
934779439 2:96960433-96960455 CCCTTGCCTTGCCAGGATGCTGG - Exonic
935177589 2:100663398-100663420 CCCAGCTCCTGCCAGGCTGCGGG + Intergenic
937369623 2:121288143-121288165 CCAAGCCCTGCCCAAAATGCAGG + Intergenic
941892136 2:170593585-170593607 TCCAGCTCTTGCTAAGAGGCAGG - Intronic
942076207 2:172359190-172359212 TCCTGCCCTTCCCAAGATGGAGG + Intergenic
942271660 2:174281750-174281772 CCAAACCTTTGCCAAGATGTTGG + Intergenic
944589077 2:201200505-201200527 CCCAGCCTTTGCCAAGCTCCAGG - Intronic
946057671 2:216916136-216916158 CCCAGCCCCTGCAAAGATGCAGG - Intergenic
948211214 2:236194713-236194735 CACAGACCTTGCCAAGCTTCAGG - Intergenic
948634912 2:239328810-239328832 GCCAGCCCTGGCCAAGAGTCAGG + Intronic
948760193 2:240185499-240185521 CCCAGTCCTTTCCTAGATGAAGG + Intergenic
948760268 2:240185933-240185955 CCCAGTCCTTTCCTAGATGAAGG + Intergenic
1168955628 20:1832481-1832503 CCCAGCCCTGGCCTGGGTGCTGG - Intergenic
1169022374 20:2339781-2339803 CCCAGCCCTCACCAAGGTGCAGG + Intronic
1170327739 20:15175848-15175870 CCCAGCCCCTACCAAGTTGATGG + Intronic
1171377065 20:24700741-24700763 CCCAGGCCTTGTCAATATCCAGG - Intergenic
1172490497 20:35332703-35332725 CCCAGCCCTTGCTAAGACCTAGG - Intronic
1172771902 20:37386867-37386889 CCCAGCCCAGGCCAAGAGTCAGG + Intronic
1172799617 20:37566778-37566800 CCGAGCACTTGCCAAGGTGGAGG + Intergenic
1175367660 20:58467015-58467037 CCCAGGTCTTGCAAAGCTGCGGG + Intronic
1175446393 20:59023107-59023129 CCAAGCCCTGGTCAAGACGCAGG + Intronic
1175545123 20:59773140-59773162 CCCAACTAATGCCAAGATGCTGG - Intronic
1175901961 20:62363504-62363526 CCCCTCCCCTGCCAGGATGCAGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177344585 21:19853547-19853569 CCCACCTCTTGCCATGTTGCAGG - Intergenic
1177610825 21:23445671-23445693 CACTGCCCTTGCCAAGAGGAAGG + Intergenic
1179517466 21:41918555-41918577 CCCTGCCCCACCCAAGATGCAGG - Intronic
1180086376 21:45509667-45509689 CCCAGCCCCTGCAGAGCTGCTGG + Intronic
1180864858 22:19112020-19112042 CCCAGCACTTTCAGAGATGCAGG + Intronic
1180904890 22:19402853-19402875 CCCAGCACTTTGGAAGATGCAGG + Intronic
1181118641 22:20650414-20650436 CTCAGGCCTGGCCATGATGCTGG + Intergenic
1182301629 22:29340343-29340365 CCTAGCCCTTGCCCTGATCCTGG - Intronic
1183241034 22:36658641-36658663 TCCAGCCCTTGCCCAGGTGCTGG + Intronic
1183479769 22:38057161-38057183 CCCTGCCCTTCCCAAGATGGCGG + Intronic
1183729977 22:39612892-39612914 ACCAGCCATTGCCAATATCCGGG - Intronic
1184229766 22:43152191-43152213 CCTACCCCTTGCAAAGAAGCCGG + Exonic
1184246017 22:43236128-43236150 CCCAGACCCTGCCAAGATCAGGG + Intronic
1185348184 22:50319700-50319722 CCCAGCCTTTGCTCAGATGCAGG + Intronic
953113118 3:39962822-39962844 CCCATTCTTGGCCAAGATGCTGG + Intronic
955105040 3:55889642-55889664 GCCATCCCTTGCACAGATGCAGG + Intronic
961629959 3:128289353-128289375 CCAGACTCTTGCCAAGATGCAGG + Intronic
961649805 3:128411617-128411639 CCCAGCCCATGGCAGGATGTCGG - Intergenic
965763182 3:172102685-172102707 CCCAGCCCTTGCCCAGACCTTGG - Intronic
968917940 4:3505357-3505379 CCTAGCCCTCGCCAGGCTGCTGG + Intergenic
969101692 4:4774454-4774476 ACCAGCCCTTGCCATCATGTTGG - Intergenic
973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG + Intronic
974294425 4:59978527-59978549 ACCACCCATTGACAAGATGCTGG + Intergenic
974650411 4:64747987-64748009 GCTAGCAGTTGCCAAGATGCCGG + Intergenic
975900512 4:79146407-79146429 CCCTACCCTTGCTAAGAAGCTGG - Intergenic
979843666 4:125479769-125479791 CGCAGCCCATGCCAACATGGTGG + Exonic
980604124 4:135066620-135066642 CCCAGAACTTGCCGAGATGCAGG - Intergenic
982304526 4:153916369-153916391 CCCAGCCCATGCTCAGATGTGGG - Intergenic
982464259 4:155710682-155710704 AGCAGCCATTGCCAAGAAGCAGG + Exonic
985494949 5:199151-199173 CCCACTCCTTGCCAGGATGGTGG - Exonic
985533201 5:445777-445799 CACAGGCCTGGCCAAGGTGCTGG + Intronic
989140949 5:38200730-38200752 CCAAGCCCTTTCTAAGATGGAGG + Intergenic
989184501 5:38610161-38610183 CCCAGCCTCTGCCCAGATGAGGG - Intergenic
989314868 5:40066748-40066770 CCCGGCGCTTGCCTAGAAGCTGG - Intergenic
990580885 5:57166596-57166618 CCCAGTCTTTAACAAGATGCAGG + Intergenic
993320533 5:86463800-86463822 ATCAGCCCTTGCCAAAATGGTGG + Intergenic
996679597 5:126217130-126217152 CTCAGCCCCTGCCAAGTAGCTGG - Intergenic
997461284 5:134054243-134054265 CCCCGCCCTAGCCACCATGCTGG - Intergenic
997483333 5:134206702-134206724 CCCAGCCCTTGGGAGGATGAGGG - Intronic
998098917 5:139415670-139415692 CCGAGCCCTGGGCAGGATGCAGG - Intronic
999426336 5:151490551-151490573 CCCAGCTCTTAGCAGGATGCAGG + Exonic
1003525206 6:6891484-6891506 CCCAGCCCTTCCCCCGAGGCGGG + Intergenic
1003643745 6:7897660-7897682 CTCAGCCCTTTCCAACCTGCAGG + Intronic
1003891200 6:10565269-10565291 CCCAGCACTTGCCCACAAGCAGG - Intronic
1006077778 6:31545452-31545474 CGCAGACCATGCCAAGAAGCTGG + Exonic
1006502621 6:34468077-34468099 CCCAGCCCTTGGGAAAATCCAGG + Intronic
1006750491 6:36373655-36373677 GCCAGCCCTTGCCCTGAGGCAGG - Intronic
1006845148 6:37056537-37056559 CCTAGGCCTTGGCAAGATGCTGG - Intergenic
1007406024 6:41636995-41637017 CTCAGCCCGTGCCAGGAAGCGGG + Intronic
1008044260 6:46835491-46835513 CCAAACCCTTGCCAAAATGACGG + Exonic
1010017500 6:71122007-71122029 CCAAGCCCTAGCCCAGAGGCTGG - Intergenic
1011242520 6:85287817-85287839 CCCAGCACCTGCATAGATGCTGG - Intergenic
1015599533 6:134898818-134898840 CCTAGCCTTTACCAAGATACTGG + Intergenic
1017719067 6:157232446-157232468 CCCAGCCCAAGGCAGGATGCTGG + Intergenic
1018697928 6:166405314-166405336 CACTGCCACTGCCAAGATGCTGG - Intergenic
1019639189 7:2094125-2094147 CACAGCCCTTGCTGAGCTGCTGG + Intronic
1019685306 7:2378806-2378828 CCCCGCCTTTGCCATGATGGCGG - Intronic
1020100242 7:5390381-5390403 CCCAGCTCTGTCCAGGATGCTGG - Intronic
1020960588 7:14797867-14797889 CCCAGAACTTGCCAAGCTGCGGG - Intronic
1023920373 7:44624813-44624835 AGCAGCCCTTGCGGAGATGCTGG - Intronic
1025200476 7:56958413-56958435 CCCAGGCCCTGCCAAGCAGCTGG + Intergenic
1025671468 7:63618519-63618541 CCCAGGCCCTGCCAAGCAGCTGG - Intergenic
1026392166 7:69912454-69912476 AGCAGCCGCTGCCAAGATGCTGG - Intronic
1028128499 7:87143278-87143300 CCCAGCCTTTCCCAAAATCCTGG - Intergenic
1028483131 7:91329738-91329760 CCCACCCCTTGCCCAGCAGCAGG + Intergenic
1028850405 7:95531268-95531290 ACCAGCCCTTAGCAAGATGTAGG - Intronic
1029479030 7:100801979-100802001 CCCTCCCCTTTCCAAGAGGCAGG + Intergenic
1030640604 7:112001839-112001861 CGCATCCCTTGCCAATAAGCAGG + Intronic
1032500159 7:132394094-132394116 CCAAGCCCTGGCCAAGACCCAGG + Intronic
1032851818 7:135801807-135801829 CCCAGCCCTGGCTAACTTGCTGG + Intergenic
1034415561 7:150962755-150962777 CCCAGCCCCTGCCATCAGGCAGG - Intronic
1034493579 7:151407403-151407425 CCCAGGCTTTGCCAGGCTGCCGG - Intronic
1035293413 7:157854248-157854270 CCCAGCCCTTGCCTTCATGTCGG - Intronic
1037651157 8:20839905-20839927 CCCAGGCCTTGGCTAGATCCTGG - Intergenic
1039725100 8:40206910-40206932 CCCAGCCCTCCCAGAGATGCTGG + Intergenic
1041167054 8:55101632-55101654 CCCAGCCCTTCTCCAGGTGCTGG + Intergenic
1042562756 8:70085406-70085428 CTCAGCCCTTGGGAAGATCCTGG - Intergenic
1043925756 8:86034905-86034927 CCATGCCCTTGCCAAGATATTGG - Intronic
1043992377 8:86771530-86771552 ACCAGACCTTTCTAAGATGCTGG + Intergenic
1044979556 8:97702352-97702374 CCCTGCCTTTGCCCATATGCAGG + Intronic
1045023704 8:98065489-98065511 CCCAGTGCTTGGCTAGATGCTGG + Intronic
1045500191 8:102738810-102738832 CCCAGCCCGAGCCACGGTGCCGG - Intergenic
1046882682 8:119327361-119327383 CTCAGCCCTTGCCAAAGTTCCGG - Intergenic
1048180300 8:132188321-132188343 TCAAGCCCTTGGCAACATGCAGG + Intronic
1048638070 8:136321618-136321640 CAAAGCCCTTGCCAAGCTACAGG - Intergenic
1048894271 8:138975549-138975571 CCCAGCCCTGGGCTAGATACTGG - Intergenic
1049222869 8:141435856-141435878 CCCAGCCCTGGCCAAGGTGAAGG + Intergenic
1049854038 8:144850555-144850577 CCCTGCCCTTCCCATGAGGCAGG - Exonic
1050619127 9:7434187-7434209 CCCATCCTGTGCCAAGATCCTGG - Intergenic
1053327528 9:37168801-37168823 CCCAGCCTTGGGCCAGATGCTGG + Intronic
1053653343 9:40191500-40191522 CCAAACCCTTGCCAAAATGATGG - Intergenic
1053751140 9:41256789-41256811 CTCTGCCCCCGCCAAGATGCAGG - Intergenic
1053903745 9:42820790-42820812 CCAAACCCTTGCCAAAATGATGG - Intergenic
1054256660 9:62821118-62821140 CTCTGCCCCCGCCAAGATGCAGG - Intergenic
1054334650 9:63794494-63794516 CTCTGCCCCCGCCAAGATGCAGG + Intergenic
1054531241 9:66184718-66184740 CCAAACCCTTGCCAAAATGATGG + Intergenic
1056485423 9:87052075-87052097 CCCTGCCCTTGTCAGAATGCAGG - Intergenic
1057529084 9:95828250-95828272 CCCAGCCATTGCCAATGTCCTGG - Intergenic
1057696196 9:97324543-97324565 CCCACCCCTGGCCCAGATGAGGG + Intronic
1060014439 9:120074190-120074212 GCCAGCCCTTGACTAGATGCTGG + Intergenic
1060104554 9:120865703-120865725 CACATACCTTGCCAAGCTGCAGG + Exonic
1061716316 9:132520725-132520747 CCCAGCCCTCACCAAGCTCCTGG + Intronic
1061798631 9:133102625-133102647 CCCAGCACCTGCCCAGAAGCTGG + Intronic
1062458704 9:136653834-136653856 CCCAGCCCTTCCCCGTATGCGGG + Intergenic
1062568246 9:137172720-137172742 CCCAGACCTTTCCAAGTTGATGG - Intergenic
1062590492 9:137272435-137272457 CCCAGGCCCAGCCCAGATGCAGG - Intronic
1062737831 9:138148052-138148074 CCCAGCACAGGACAAGATGCCGG + Intergenic
1185737381 X:2503748-2503770 CCCAGCCCCTGCCGAGGTCCAGG + Intergenic
1185817215 X:3167331-3167353 CCCAGCCCTTGCACTGATGGAGG - Intergenic
1187349021 X:18494590-18494612 CCCAGCCCTTCCTAATATGAGGG - Intronic
1188717093 X:33473890-33473912 CCAAGCTCCTGCCAAGAGGCTGG - Intergenic
1190739865 X:53281594-53281616 CCCAGCCCTTCCCTAGAAGGAGG + Intronic
1194600940 X:95920870-95920892 CCAAGGCCCTGCCAAGAAGCAGG - Intergenic
1195752116 X:108169880-108169902 GCCAGCCCTTGCCAGGCTTCTGG + Intronic
1195835161 X:109106542-109106564 ACCAGGCCTTGACAAGATCCAGG - Intergenic
1195993116 X:110702880-110702902 CCCAGCACTGCCCCAGATGCTGG - Intronic
1196937831 X:120747068-120747090 CCCAGACCTTGCCAGCCTGCAGG - Intergenic
1197753473 X:129980627-129980649 CCCCGCCCTTGCCTGGGTGCTGG - Intergenic
1200224405 X:154409273-154409295 CCCCACCCTTGCCAACAGGCAGG + Intronic
1200400376 X:156016508-156016530 CCCAGTTCAGGCCAAGATGCAGG - Intergenic
1200954463 Y:8930094-8930116 CCCAGCTCTTGCAAAGTTGCAGG - Intergenic
1200958298 Y:8972751-8972773 CCCAGCTCTTGCAAAGTTGCAGG - Intergenic
1200960549 Y:8992169-8992191 GTCAGCCCTTGCCAAAATGGTGG + Intergenic
1200986042 Y:9304192-9304214 CCCAGCTCTTGCAAAGTTGTGGG + Intergenic
1202124542 Y:21556709-21556731 CCCAGCTCTTGCAAAGTTGTGGG - Intergenic
1202154466 Y:21872671-21872693 CCCAGCTCTTGCAAAGTTGTGGG + Intergenic
1202232591 Y:22671484-22671506 CCCAGCTCTTGCAAAGTTGCAGG - Intergenic
1202310565 Y:23524674-23524696 CCCAGCTCTTGCAAAGTTGCAGG + Intergenic
1202560237 Y:26145920-26145942 CCCAGCTCTTGCAAAGTTGCAGG - Intergenic