ID: 1125762224

View in Genome Browser
Species Human (GRCh38)
Location 15:42104391-42104413
Sequence TTGTAGTCCAGGATCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125762224_1125762227 -3 Left 1125762224 15:42104391-42104413 CCCACATAGATCCTGGACTACAA No data
Right 1125762227 15:42104411-42104433 CAACCCTCCCAAGACCACTGAGG No data
1125762224_1125762236 24 Left 1125762224 15:42104391-42104413 CCCACATAGATCCTGGACTACAA No data
Right 1125762236 15:42104438-42104460 CGCATGCTTAGCTGCCATCTCGG No data
1125762224_1125762228 -2 Left 1125762224 15:42104391-42104413 CCCACATAGATCCTGGACTACAA No data
Right 1125762228 15:42104412-42104434 AACCCTCCCAAGACCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125762224 Original CRISPR TTGTAGTCCAGGATCTATGT GGG (reversed) Intergenic
No off target data available for this crispr