ID: 1125766737

View in Genome Browser
Species Human (GRCh38)
Location 15:42141403-42141425
Sequence CGAGGAGACCAGAAGGCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125766728_1125766737 26 Left 1125766728 15:42141354-42141376 CCACAGGCTTTAGGGCGCTGGGA 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 418
1125766724_1125766737 28 Left 1125766724 15:42141352-42141374 CCCCACAGGCTTTAGGGCGCTGG 0: 1
1: 0
2: 2
3: 7
4: 113
Right 1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 418
1125766726_1125766737 27 Left 1125766726 15:42141353-42141375 CCCACAGGCTTTAGGGCGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG 0: 1
1: 0
2: 5
3: 44
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125766737 Original CRISPR CGAGGAGACCAGAAGGCAGA AGG Exonic
902643088 1:17779205-17779227 AGAGGGGTCCAGGAGGCAGAGGG - Intronic
902751630 1:18516668-18516690 CGTGGATGCCAGAAGGCAGTGGG + Intergenic
902968414 1:20029169-20029191 TGTGGAAACCAGAAGGGAGATGG + Intronic
903129839 1:21271672-21271694 GGAGGAGCCCAGTGGGCAGACGG + Intronic
903256978 1:22108998-22109020 TGAGGAGACTAGAAGACAGTGGG + Intergenic
904045102 1:27603962-27603984 CGGAGAGAGCAGAAGGCAGGAGG - Intronic
904475548 1:30762414-30762436 AGATGGGACCAGCAGGCAGAAGG + Intergenic
904973005 1:34433789-34433811 AGAGAAGACCACAAGGCAGAGGG + Intergenic
905004599 1:34699534-34699556 AGTGGAGACCAGAGTGCAGAGGG + Intergenic
905006582 1:34714747-34714769 CCAGGAGACAAGGAGGTAGAAGG - Intronic
906110127 1:43317169-43317191 GGATGAGACAAGAGGGCAGACGG - Intronic
906458405 1:46018350-46018372 GGAGGAGTCCAGCAGGCAGCTGG - Intronic
906660194 1:47576444-47576466 CTAAGAGACAAGAAGGTAGAGGG + Intergenic
906892556 1:49733104-49733126 AAAGGAGGCCAGAAGGCAGTAGG + Intronic
907194900 1:52678606-52678628 TGTGGAGACCAGACTGCAGAGGG + Intergenic
907285400 1:53376549-53376571 CGTGGAGCCCAGAATGGAGAGGG + Intergenic
907289910 1:53407125-53407147 CATGGAGACCAGATGACAGAGGG + Intergenic
907300127 1:53481841-53481863 GTAGGAGACCAGCAGGCAGGAGG - Intergenic
908097877 1:60759309-60759331 AGAGGAGACTAGACGGCAAAAGG + Intergenic
908339674 1:63163855-63163877 GGAGGGGACAAGAAGGAAGATGG + Intergenic
909538088 1:76760657-76760679 AGAGGACACCAGAAGGCAAATGG + Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
914775524 1:150730542-150730564 TGGGGAGAACAGCAGGCAGAAGG + Exonic
915225658 1:154409351-154409373 GGAGGAGAGCAGAAGGCAGAGGG - Intronic
916056453 1:161071996-161072018 AGAGGCCACCAGAGGGCAGAGGG + Exonic
916663689 1:166946787-166946809 TTAGGAGACTAGAAGGCAGTTGG - Intronic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
917474650 1:175358581-175358603 CAAAGATACCAGAAGACAGAAGG - Intronic
917631865 1:176898310-176898332 CGAGGGGACCAGAAGGCAGTGGG - Intronic
918093342 1:181315820-181315842 CTAGGATACCAGACGGCTGATGG - Intergenic
918260200 1:182789272-182789294 CGAAGAGACCTGAACGCCGATGG + Intronic
919851968 1:201678986-201679008 CGGGGAGCCCAGAAGGGAGGAGG + Intronic
921079258 1:211725584-211725606 GGAGGAGACCAGGGGGCAGTGGG - Intergenic
922286016 1:224171312-224171334 AGTGGAGGCCAGAAGGCAGTGGG - Intergenic
923016918 1:230133962-230133984 GGAGGAAACCAGAAAGCAAAAGG - Intronic
923500750 1:234561564-234561586 CTAGGAGACCAGTAGGCAACTGG + Intergenic
1063306475 10:4907159-4907181 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1064017763 10:11786033-11786055 CGCGAACATCAGAAGGCAGAGGG - Intergenic
1064288271 10:14011524-14011546 CCAGGAGATTGGAAGGCAGATGG - Intronic
1064966792 10:21022232-21022254 CGTGGATACCAGAAAGGAGAGGG - Intronic
1066003233 10:31124165-31124187 GGAGGAGAGCAGATGGCAAATGG + Intergenic
1066668746 10:37814707-37814729 CTTGGAGGCCAGAAGGCAGTGGG - Intronic
1066671403 10:37844166-37844188 CATAGAGACCAGAAGGCAGTGGG + Intronic
1067663411 10:48253435-48253457 CATGGAGACCAAAAGGCAGTTGG + Intronic
1067841671 10:49685661-49685683 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1068493331 10:57752367-57752389 CATAGAGACCAGAAGGCAGTGGG - Intergenic
1069641266 10:69956978-69957000 CAAGGAGAAAGGAAGGCAGAGGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070826285 10:79392142-79392164 CGAGCACTCCAGAGGGCAGATGG - Intronic
1071748741 10:88451236-88451258 TGTGCATACCAGAAGGCAGAGGG - Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073066363 10:100761728-100761750 CCTGGAGACCAGTAGCCAGAGGG - Intronic
1073461340 10:103667562-103667584 AGAGGAGAAGAGAAGGCAGTGGG - Intronic
1075420415 10:122296363-122296385 AGGCCAGACCAGAAGGCAGATGG - Intronic
1075511014 10:123073187-123073209 TGAGGAGCACAGAAGACAGATGG - Intergenic
1075518913 10:123132402-123132424 CAAGGAGCCAAGAGGGCAGAAGG - Intergenic
1076013088 10:127006255-127006277 GCAGGAGAGCAGAAGGCAGGAGG - Intronic
1076478226 10:130767263-130767285 CGAGGAGACAAGTAGGCACGAGG + Intergenic
1076668592 10:132106569-132106591 CTCGGATACCAGAAGGCCGATGG + Intronic
1076763503 10:132617332-132617354 AGATCAGACCAGGAGGCAGAAGG - Intronic
1076791181 10:132777647-132777669 TGGGGAGACATGAAGGCAGAGGG - Intronic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077325076 11:1960213-1960235 GGAGGAGGACAGAAGACAGAGGG - Intronic
1077367736 11:2167925-2167947 CGAGAAGCCCTGAGGGCAGAGGG + Exonic
1077485389 11:2836111-2836133 AGATGAGACCAAGAGGCAGATGG + Intronic
1077813081 11:5658335-5658357 TGAAGAGGCCAGAAGGAAGATGG - Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078426314 11:11253857-11253879 CCAGGACACCTGCAGGCAGAAGG - Intergenic
1079136633 11:17779295-17779317 CGAGGAGGGCACAAGGCAGGGGG - Intronic
1079483242 11:20906104-20906126 CATGGAGACCAGAAGGCAATGGG + Intronic
1080680234 11:34469107-34469129 CCAGGAAACCAGAAGTGAGAGGG - Intronic
1081118759 11:39237699-39237721 ATCGGAGACCAGAAGGCAGAAGG - Intergenic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1083536775 11:63476532-63476554 AATGGAGACCAGAAGGCAGTGGG - Intronic
1083603190 11:63961523-63961545 CTAGGGGCTCAGAAGGCAGAGGG + Intergenic
1083724496 11:64621214-64621236 CGAGGGGGCAAGAATGCAGAAGG - Intronic
1084461433 11:69298705-69298727 CGTGGAGACCAGGAGGAAGCTGG + Intronic
1084972579 11:72780006-72780028 GGAGGATAGCAGAAGGGAGAAGG + Intronic
1085296555 11:75434820-75434842 CCAGCAGACCTCAAGGCAGAAGG - Exonic
1087208994 11:95427073-95427095 CTATGAGACCCGAAGGGAGAGGG - Intergenic
1089644582 11:119870306-119870328 GGAGGTGACCAGCAGGCAGCTGG - Intergenic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090872044 11:130757553-130757575 CGAGGAGAGGAGAGGTCAGATGG + Intergenic
1090941217 11:131389900-131389922 AAAGGAGACCAGAAGGGTGAGGG + Intronic
1091061574 11:132467973-132467995 CGTGGAGATCAGAAGCTAGAGGG - Intronic
1202808058 11_KI270721v1_random:15392-15414 GGAGGAGGACAGAAGACAGAGGG - Intergenic
1091593645 12:1860309-1860331 GGAGGAGACAAGAAGGCGGAGGG - Intronic
1091793010 12:3282216-3282238 AGAGGAGTGCAGGAGGCAGAAGG - Intronic
1095709922 12:45277430-45277452 GGAGGAGATCAGAAGGCTGTGGG - Intronic
1095799860 12:46260564-46260586 GGAGCAGTCCAGAAGGCAGCAGG - Intronic
1095871036 12:47028282-47028304 CAAGGAGAGAAGAAAGCAGACGG + Intergenic
1096542170 12:52314043-52314065 CGAGGAGGCCAGAAGTCAGCCGG - Intergenic
1097427403 12:59463846-59463868 CATGGAGACTAGAAGGCAGTAGG + Intergenic
1097908815 12:64947698-64947720 CAAGGAGACCTGAATGGAGAAGG - Intergenic
1100211438 12:92402520-92402542 GGAGGAGAATAGAAGGGAGAGGG - Intergenic
1100861241 12:98809638-98809660 TGATGTCACCAGAAGGCAGAGGG + Intronic
1101905374 12:108820867-108820889 CGATGAGGTCGGAAGGCAGAGGG - Intronic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102560774 12:113760796-113760818 GGAGAAGCCCAGAAAGCAGATGG - Intergenic
1104097612 12:125572391-125572413 AGAGGATTGCAGAAGGCAGAGGG - Intronic
1104672005 12:130686866-130686888 CTACGAGCCCAGAAGGCAGCGGG + Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1105284407 13:18992904-18992926 AGACGAGAACAGAAGGCAGAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284561 13:18993722-18993744 CCAGAAGGCCAGAAAGCAGAAGG + Intergenic
1105284609 13:18994024-18994046 GCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1105284639 13:18994173-18994195 CCAAAAGGCCAGAAGGCAGAAGG + Intergenic
1105284671 13:18994391-18994413 CTAGAAGACCAGCAAGCAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284765 13:18994947-18994969 CAAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284961 13:18996109-18996131 CCCGGAGGCCAGAATGCAGAAGG + Intergenic
1105284975 13:18996189-18996211 CTAGAAGGCCAGAAGGCAGAGGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105413249 13:20189206-20189228 CGAGGAGATCAAAACCCAGAAGG - Exonic
1105917424 13:24929448-24929470 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1106204253 13:27574876-27574898 CATGGAGACTAGAAGGCAGTGGG + Intronic
1108410772 13:50144294-50144316 GGAGGGGACCACATGGCAGAGGG - Intronic
1109264525 13:60182173-60182195 GGAGGAGAAGAGATGGCAGAAGG - Intergenic
1109986449 13:69992547-69992569 TGAGGAGACCAAAACACAGAAGG + Intronic
1111630355 13:90841110-90841132 CGAGGAGGCGAGAGGTCAGATGG - Intergenic
1113354515 13:109565807-109565829 AGAGATGACCAGAATGCAGATGG - Intergenic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113869906 13:113553018-113553040 CCAGGAGAGGAGAAGGCAGCAGG - Intronic
1115275602 14:31605814-31605836 GGAGGAGACGAGAAAGGAGAAGG - Intronic
1115497826 14:34024545-34024567 GGAGGAGAAGAGAAGGGAGAAGG - Intronic
1115780321 14:36761256-36761278 AGAGGAGAGCAAAAGGCAGACGG - Intronic
1115999076 14:39223969-39223991 GGAGCAGACGAGAAGGGAGATGG - Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1118436869 14:65779573-65779595 CAAGGAAAAAAGAAGGCAGAAGG + Intergenic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119484949 14:74981088-74981110 ACAGGAGACCAGCAGGCAGCAGG - Intergenic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121682591 14:95806143-95806165 CAAAGAGGCCAGAAGGCAGTGGG - Intergenic
1121777096 14:96598200-96598222 AGAGGAGAGGAGAAGGAAGAGGG - Intergenic
1121916431 14:97840272-97840294 CCAGGAGACCAGAAGGCATCTGG - Intergenic
1121995964 14:98603105-98603127 GGAGAAGAACAGCAGGCAGAGGG + Intergenic
1122304238 14:100751609-100751631 CTCGGAGAACAGAAGGCAGTGGG - Intergenic
1124070467 15:26388301-26388323 GGAGGAGAGCTGGAGGCAGAGGG - Intergenic
1124245204 15:28064117-28064139 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1125477873 15:40059823-40059845 CGAGGTGTCCACTAGGCAGACGG + Intergenic
1125494603 15:40180602-40180624 CAAGGAGGCCAGAAGACAGTGGG - Intronic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126461502 15:48919660-48919682 AGAAGAGAGCTGAAGGCAGAGGG - Intronic
1128053561 15:64683562-64683584 TGAGGGCAGCAGAAGGCAGAGGG - Exonic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128512659 15:68322944-68322966 CGAGGACCTCAGCAGGCAGATGG + Intronic
1130866077 15:87934243-87934265 CTATGAGGCCAGAAGGCAAATGG + Intronic
1131014174 15:89043606-89043628 GGAGGAGACGAGGAGGCGGAAGG + Intergenic
1132801281 16:1755363-1755385 CGAGGACAACAGAATGCAGCCGG + Intronic
1134432568 16:14224653-14224675 CTTGAAGACCAGAAGGCAGTGGG + Intronic
1134849314 16:17468121-17468143 CCAGGAGACCAGAAGGGGGCAGG - Intronic
1135118072 16:19740475-19740497 GCAGCAGAACAGAAGGCAGAGGG - Intronic
1136171890 16:28494825-28494847 TGAGGAGATCAGAAGGAGGAGGG - Intronic
1136749866 16:32624995-32625017 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1137312455 16:47278257-47278279 CGAGGAGAACACAAGTCACAGGG + Intronic
1137540920 16:49361076-49361098 CAAGGGGACTAGAAGGGAGAGGG - Intergenic
1138060982 16:53889968-53889990 CGAGGAGACCAAAACACAAAGGG + Intronic
1138181764 16:54945325-54945347 CGAGGAGAAAAGAAGGGAAAAGG - Intergenic
1138351371 16:56347848-56347870 AGAGAAGACCAGGAGGCAGGAGG - Exonic
1138432127 16:56975715-56975737 TGAGGTGACCAGAAAGCTGAGGG - Intronic
1138592517 16:58009847-58009869 GAAGAAGCCCAGAAGGCAGAGGG - Intronic
1139320435 16:66109778-66109800 GGAGGGGAGAAGAAGGCAGAAGG + Intergenic
1141224452 16:82101694-82101716 CAAGGAGAAGAGAAGGCGGAGGG + Intergenic
1141430817 16:83969393-83969415 AAAGGAGACGAGAAGACAGAAGG - Intronic
1203052000 16_KI270728v1_random:884193-884215 CTTGGAGGCCAGAAGGCAGTAGG - Intergenic
1142742307 17:1938157-1938179 GGAGGAGAGCAGGAGGCTGACGG - Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143235259 17:5394091-5394113 GGAGGAGCCCAGTAGGCAGCTGG + Intronic
1143483479 17:7239711-7239733 CGGGGAGACCAGGAGCCGGAGGG + Intronic
1144371345 17:14594489-14594511 TGAGGAGACGAGCAGGCAGATGG + Intergenic
1144440582 17:15277521-15277543 TGGGGAGAGCAGAAGGCAGCTGG + Intergenic
1144483848 17:15648886-15648908 TAAGCAGACCAGAAAGCAGAGGG + Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1145314294 17:21720070-21720092 CGAGCACAGCAGAGGGCAGAGGG + Intergenic
1145712741 17:26992049-26992071 CGAGCACAGCAGAGGGCAGAGGG + Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1147196238 17:38768683-38768705 GGAGGAGGTCAGAAGGAAGAAGG + Exonic
1147265604 17:39232461-39232483 CGAGTGGACTGGAAGGCAGAGGG + Intergenic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148716607 17:49720285-49720307 GGAGGAGAACAGAGGGGAGAGGG + Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1149475950 17:56960924-56960946 CAAGTCGACCAGAAGCCAGAAGG + Exonic
1150170980 17:62994254-62994276 CCAGGAACCCAGGAGGCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150718591 17:67594547-67594569 GCAGGAGGCCACAAGGCAGAGGG - Intronic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1151405706 17:73884869-73884891 ACAGGAGACCAGAAGGCGGGAGG - Intergenic
1151430763 17:74060970-74060992 AGAGGAGAGCAGAAAGAAGAAGG - Intergenic
1151483327 17:74383266-74383288 GGAGGAGACCTGGGGGCAGAGGG + Intergenic
1152506748 17:80754378-80754400 CGAACAGATCAGAAGGAAGAAGG - Intronic
1152810247 17:82378457-82378479 CGAGCAGACCGGAAGGCGGTGGG - Intergenic
1153310175 18:3669679-3669701 TGAGGAAGCCAGAAGGAAGATGG - Intronic
1153805752 18:8706811-8706833 CGTGGAGAGCAGGAGGGAGAAGG - Intronic
1156326733 18:36080231-36080253 CTGGGAGACCTGAAGACAGATGG + Intergenic
1156549780 18:38003660-38003682 TGAGGAGACAAGCAGACAGACGG + Intergenic
1156875520 18:42005948-42005970 CCAGTAGGCCAGAAGTCAGAAGG - Intronic
1157149557 18:45202924-45202946 GGAGGAAACCATATGGCAGAGGG + Intergenic
1157190960 18:45581196-45581218 AGATGAGAACAGAGGGCAGAGGG + Intronic
1157575851 18:48742485-48742507 CAAGGAGGCCCGAATGCAGAAGG - Intronic
1158090896 18:53712115-53712137 AGAGGAAATCAGAATGCAGAGGG + Intergenic
1158150828 18:54367795-54367817 CAAGGAGAAGAGAAGGCAAAAGG - Intronic
1158505728 18:58044568-58044590 CGGGGGGACCTGGAGGCAGAGGG + Exonic
1158587798 18:58756384-58756406 AGACGAGACTAGAGGGCAGAGGG + Intergenic
1160337256 18:78053715-78053737 GTAGGAGACCAAAAGGCAAAAGG - Intergenic
1160556728 18:79730371-79730393 CCAGGAAACCAGGAGGGAGACGG - Intronic
1160873592 19:1287481-1287503 CGAGGACAGCAGGAGACAGAGGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161086911 19:2339641-2339663 AGAGGAGACCACACAGCAGAGGG - Intronic
1161676266 19:5651746-5651768 CGAGGAGCCCTGAATGCAGGAGG - Intronic
1161760573 19:6168139-6168161 AGAGGAGAGGAGAAGGGAGATGG - Intronic
1161920219 19:7260414-7260436 TGAGGGGACCAGAAGCCACAGGG - Intronic
1162453992 19:10771531-10771553 CAAGGAGCCCACAAGGTAGAGGG - Intronic
1163720831 19:18897419-18897441 CCAGGATACCAGACGGAAGAGGG - Intergenic
1164781487 19:30896929-30896951 CCTGGAGACCAGAAGGCCCAGGG + Intergenic
1165100537 19:33436115-33436137 CGGGGAGAAAAGAAGGGAGAAGG + Intronic
1165940048 19:39410379-39410401 AGAGAAGAACAGAAGGCAAAGGG - Intergenic
1167168264 19:47813910-47813932 GAGGGAGACCAGAAGACAGAGGG + Intronic
1167277765 19:48549235-48549257 GGACGAGACCAGAAGGATGAAGG - Intergenic
1168048303 19:53809933-53809955 CGAGGAGACCAGGAGCCACCTGG - Exonic
1168726161 19:58583288-58583310 GGAGGAGACAAGAAGAGAGAGGG - Intergenic
925379887 2:3417339-3417361 GGAGGAGAGCAGCAGGCAGCGGG - Intronic
925601214 2:5610503-5610525 GGAGGGCACCAGAAGGCAGCAGG + Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
926644940 2:15280346-15280368 GGAGGAGGCAAGAAGGAAGAAGG + Intronic
926677466 2:15638290-15638312 GGAGAAAAGCAGAAGGCAGAAGG - Intergenic
927517259 2:23679764-23679786 GGAGGAGGGCAGAGGGCAGAGGG + Intronic
927538775 2:23887943-23887965 CGAGGGGAAAAGAAGGGAGATGG - Exonic
927937051 2:27082059-27082081 TGAGGAGAGGGGAAGGCAGAAGG - Intronic
928851966 2:35759197-35759219 TGAGGAGAGGAGAAGGAAGAGGG - Intergenic
929177637 2:38997635-38997657 CATGGAGGCCAGAAGGCAGTGGG + Intronic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
931112012 2:59120958-59120980 CGATCAGAGCAGAAGGCAAAGGG - Intergenic
932584962 2:73021967-73021989 TGTGGAGACCAGGAGGCAGAGGG - Intronic
932744140 2:74317712-74317734 CTAGGAGTCCAGCAGGCAAAGGG - Intronic
933577943 2:84091443-84091465 CATGGAGACCAGAAGACAGTAGG + Intergenic
934049358 2:88197621-88197643 GGAGGTGAACAGCAGGCAGAGGG - Intergenic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
935319708 2:101874100-101874122 GGATGAGACCAGAAGCCATAAGG + Exonic
935840219 2:107101138-107101160 ATAGAAGATCAGAAGGCAGATGG + Intergenic
936411719 2:112264472-112264494 CTAGGAGACCATAATGAAGAAGG + Intergenic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
936728193 2:115348062-115348084 GTAGGAGACAGGAAGGCAGAAGG + Intronic
937722255 2:125115112-125115134 CCTAGAGACCAGAAGGCAGTTGG + Intergenic
937904910 2:127048388-127048410 AGAGGAGACCCCCAGGCAGAGGG - Exonic
937990479 2:127659414-127659436 CGTGGAGACCAGCAGGGAGCTGG - Intronic
938844021 2:135189749-135189771 CTTGGAGGCCAGAAGGCAGTAGG + Intronic
939936063 2:148294874-148294896 AATGGAGACCAGAAGGCAGAGGG - Intronic
942057009 2:172193447-172193469 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
944325602 2:198400267-198400289 CTAGGAGACTAGAAGGAATAAGG + Intronic
944770691 2:202911624-202911646 AGAGGAGACCGGAGGGCAGAAGG - Exonic
945781899 2:214185776-214185798 TGTGGAGACCAGAGAGCAGAGGG + Intronic
945968149 2:216210104-216210126 AGAGGAAAGCAGAAGGAAGATGG + Intergenic
947085890 2:226452489-226452511 GAAGGAGAAAAGAAGGCAGAGGG + Intergenic
947757891 2:232581518-232581540 AGAGGAGACCGGAGGGCATAAGG - Intronic
948077187 2:235174052-235174074 GGAGGAGGTCAGGAGGCAGAGGG + Intergenic
948807246 2:240458394-240458416 CAAGGACACCAGGAGGCACAGGG + Intronic
949021941 2:241745881-241745903 CGAGGAGGCCAGAGGACAGCGGG - Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
1168849927 20:969538-969560 AAAGGAGACCAGGAGACAGAAGG + Intronic
1169039931 20:2484604-2484626 GGAGAAGGCCAGAAGGCAGGAGG + Exonic
1169499153 20:6142443-6142465 CGAGGAGAAAAGAAGACGGATGG + Intergenic
1173473113 20:43338764-43338786 CGAGGTGCCCAGATTGCAGACGG - Intergenic
1175738829 20:61406361-61406383 CGGGCAGAGCAGATGGCAGATGG - Intronic
1175738900 20:61406718-61406740 CGGGCAGAGCAGATGGCAGATGG - Intronic
1175738927 20:61406851-61406873 CGGGCAGAGCAGATGGCAGATGG - Intronic
1176299172 21:5090551-5090573 AGAGGAGACCGGGAGGCAGGCGG + Intergenic
1177357755 21:20031191-20031213 CAAGGAGAACAGAAGACAGATGG - Intergenic
1177564109 21:22796209-22796231 TGGGGAGACCAGAAGGGAGATGG + Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179857854 21:44171397-44171419 AGAGGAGACCGGGAGGCAGGCGG - Intergenic
1181311347 22:21946526-21946548 CGTGGTGACCAGATGGCAGGAGG + Intronic
1182585382 22:31341736-31341758 GGAGGAGCCCAGAGGGCAGTGGG - Intronic
1182787642 22:32920827-32920849 GCAGGAGACTGGAAGGCAGAGGG + Intronic
1183473879 22:38025075-38025097 CCAGGACACCAGGAGACAGAAGG - Intronic
1184892102 22:47386349-47386371 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184892332 22:47387607-47387629 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184924999 22:47630510-47630532 AGGTGAGACCAGAAGGCAGAGGG - Intergenic
1185113887 22:48920263-48920285 CGAGGGGACCAGAAGCAAGCAGG - Intergenic
1185324353 22:50218405-50218427 GGCGGAGGGCAGAAGGCAGAGGG + Intronic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
949265216 3:2149186-2149208 GAAGGCCACCAGAAGGCAGACGG - Intronic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
950334347 3:12181823-12181845 GGAGGAGTCCTGAAGGCTGATGG + Intronic
951747231 3:25992817-25992839 CGATGAAACCAGGAGGCAGTGGG + Intergenic
953885463 3:46712360-46712382 GGAGGAGACCTGTAGGTAGATGG + Exonic
953964640 3:47294497-47294519 TGAGGATATCTGAAGGCAGAGGG + Intronic
954889081 3:53906631-53906653 CACGGAGGCCAGAAGGCAGTGGG + Intergenic
959676937 3:109046244-109046266 CGTGGAGACTAGAAGGGAGAGGG + Intronic
960041005 3:113149828-113149850 AGAGGAGACCTGAAGGCTGCTGG - Intergenic
961862676 3:129929545-129929567 CGTGGAGACAAGAAGGCAAAGGG - Intergenic
962203502 3:133417549-133417571 AGAGGAGAGTAGAAGGGAGAGGG - Intronic
963265191 3:143233172-143233194 GGAGGAGTCCAGATGGCAGTTGG - Intergenic
965678941 3:171230648-171230670 TGAGGAGTCAAGAAGGCAAAGGG - Intronic
965708168 3:171530554-171530576 TGAAGAGAACAAAAGGCAGAAGG - Intergenic
965734116 3:171802931-171802953 AGAGGGGCCCAGAAGGCACATGG + Intronic
966431028 3:179831856-179831878 AGTGTAGACCTGAAGGCAGAAGG + Intronic
966532088 3:180992464-180992486 TCAGGAGATCAGAAGGCAGGAGG + Intergenic
968026800 3:195449427-195449449 CTAGGAGAGGAGAAAGCAGAAGG - Intergenic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
968592009 4:1464035-1464057 CGAGAAGACCAGAAGGCCCTGGG + Intergenic
968987016 4:3880950-3880972 CGGGGAGACGGGAAGGAAGAGGG + Intergenic
969315568 4:6379753-6379775 GGAGGAGCCCAGAGTGCAGAGGG - Intronic
969343275 4:6555813-6555835 CGAGGAGACCAGCAAGCACCCGG - Intronic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
971226419 4:24756824-24756846 AGAGGAGGCCAGAAGACAGTGGG - Intergenic
972174429 4:36386142-36386164 GCAGGAGATCAAAAGGCAGAAGG - Intergenic
974700844 4:65443728-65443750 AAAGGAGACTAGAAAGCAGATGG - Intronic
975191372 4:71466873-71466895 AGAGGAAGCCAGAAGGCAAAGGG - Intronic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
978841893 4:113224060-113224082 AAAAGAGACAAGAAGGCAGAAGG + Intronic
978916835 4:114136433-114136455 CAAGGAGACCAGGAGGCAATGGG + Intergenic
981376024 4:144016833-144016855 AGAAGAGGACAGAAGGCAGAGGG - Intronic
981643856 4:146975676-146975698 CTCTGAGACCAGATGGCAGATGG + Intergenic
982341941 4:154309332-154309354 GAAGGAGACCAAAAGTCAGAAGG + Intronic
982636709 4:157905837-157905859 TGTGGAGAACAGAAGTCAGAAGG + Intergenic
983345465 4:166522158-166522180 CGAGGAGAGGAGAGGTCAGATGG - Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984369564 4:178845215-178845237 CATGGAGGCCAGAAGGCAGTGGG + Intergenic
984842132 4:184078541-184078563 TGAGGAGACCAGCAGGAACACGG + Intergenic
985057755 4:186050024-186050046 GGAGCAGTCCAGAAGACAGATGG - Intergenic
985515008 5:337896-337918 AGAGGAGCCCAGCAGGAAGAAGG - Intronic
985921296 5:2978186-2978208 AGAGGAGAACAGAAGGAAGTAGG - Intergenic
986075312 5:4330827-4330849 GGAGTAGAGCAGAGGGCAGAGGG + Intergenic
986206552 5:5630104-5630126 TGAGGACACCAGAAGCCTGATGG - Intergenic
987274380 5:16346577-16346599 AGAGGAAAGCAGAAGACAGAAGG + Intergenic
987793973 5:22604961-22604983 CAAGGAGCCCAGAAGAGAGAGGG - Intronic
988657966 5:33233444-33233466 AGAGGAAAACAGAAGGCAGGTGG + Intergenic
989108902 5:37888564-37888586 CGAGTAAACCATCAGGCAGAAGG + Intergenic
989772490 5:45161401-45161423 CAAGGTGACCAGAAGACAGTGGG - Intergenic
989783997 5:45305112-45305134 AGAGGTGAAAAGAAGGCAGAAGG + Intronic
991402548 5:66268835-66268857 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
992094334 5:73347240-73347262 CATGGAGGCCAGAAGGCAGTAGG + Intergenic
992368379 5:76116465-76116487 TGGGAAGAGCAGAAGGCAGAGGG - Intronic
992623449 5:78616042-78616064 GGAGAAGAACAGAGGGCAGAAGG - Intronic
993329421 5:86579457-86579479 CTAGGAGACCAGTAGGAAGGGGG - Intergenic
993367843 5:87054846-87054868 GAAGGAGACCAGAACACAGAAGG - Intergenic
993482405 5:88440009-88440031 AGAGGAGACCAGAAGAAAAAAGG + Intergenic
994276876 5:97849367-97849389 ACAGGAGACCTGAAGGCAGGTGG + Intergenic
994919448 5:106024514-106024536 ACAGGAGAACCGAAGGCAGAAGG + Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
995180974 5:109229865-109229887 TGAGAAGAGCAGGAGGCAGAGGG + Intergenic
995735075 5:115291820-115291842 CATGGACACCAAAAGGCAGAGGG - Intronic
996367506 5:122718768-122718790 CAAGGAGACCAGAAGTTAGATGG - Intergenic
997606952 5:135182044-135182066 AGCTGAGACAAGAAGGCAGAGGG + Intronic
997703053 5:135918423-135918445 CGAGGAGTCCAGTAGACAGCTGG + Intergenic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998915077 5:147003819-147003841 CGAGGAAGGTAGAAGGCAGAAGG - Intronic
999096157 5:148979721-148979743 GGATTAGGCCAGAAGGCAGACGG - Intronic
999175470 5:149628867-149628889 AGAGGAGCTCAGAAGGCAGGCGG + Exonic
999806329 5:155084767-155084789 CGAGCAAATCAAAAGGCAGAAGG - Intergenic
1000731468 5:164839063-164839085 AGAAGAGCCCAGAAAGCAGAAGG - Intergenic
1001135788 5:169101522-169101544 CAAGGAGTCCTGGAGGCAGATGG - Intronic
1002691192 5:181052007-181052029 CGAGGAGGCCAGAGGGTCGAGGG + Intronic
1002870634 6:1164580-1164602 CAAGGAGAGCCCAAGGCAGAGGG + Intergenic
1005730652 6:28693819-28693841 TGAGGAGACCAGAAGGGAAAGGG - Intergenic
1007336583 6:41159069-41159091 TGGAGAGACAAGAAGGCAGATGG + Intronic
1007555460 6:42762036-42762058 CGTGGTGACTGGAAGGCAGAAGG - Intronic
1007794820 6:44339040-44339062 AGAGGAAACCAGACAGCAGAGGG - Intronic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1012220717 6:96646158-96646180 CGAGGAGCTCAGGAGTCAGAGGG - Intergenic
1013154559 6:107481074-107481096 TGAGGAAATCTGAAGGCAGAGGG - Intergenic
1013978165 6:116100620-116100642 CTAGGAGCCCAGAAGGCAGTAGG - Intergenic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1014856860 6:126412376-126412398 CAAGGAGGCCAGAAGGCAGTGGG - Intergenic
1015145042 6:129976245-129976267 CGTGCAGACCAGCAGGCAGGAGG - Intergenic
1015671330 6:135693257-135693279 CCTGGAGAAGAGAAGGCAGAAGG + Intergenic
1016408527 6:143757273-143757295 TGAGGAGACCAGAATGCAAACGG + Intronic
1018293780 6:162322521-162322543 CAATGAGACCCGAAGTCAGATGG - Intronic
1018301596 6:162408940-162408962 GGAGGGGAGGAGAAGGCAGAGGG - Intronic
1018567691 6:165172910-165172932 CAGGGAGACGTGAAGGCAGAAGG + Intergenic
1019256742 7:57285-57307 CGGGAAGACCAGGAGGCACAGGG - Intergenic
1019357812 7:590101-590123 CCTGGAGACCAGAAGACAGAGGG + Intronic
1019596506 7:1860865-1860887 CGGAGAGCCCAGAAGGCACAGGG - Intronic
1021035514 7:15793783-15793805 CAAGGAGAAGAGAAGGTAGAAGG + Intergenic
1022855501 7:34309953-34309975 GGAGGATACAAGCAGGCAGACGG - Intergenic
1024106212 7:46089112-46089134 AGTGGAGGCCAGAAGGCAGTGGG - Intergenic
1024440268 7:49408427-49408449 TGAGGAGGCCAGAAGGCGGATGG - Intergenic
1024735432 7:52299745-52299767 GGAGAAGACAAGGAGGCAGAAGG - Intergenic
1026065638 7:67070053-67070075 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1026351928 7:69524681-69524703 CATGGAGCCCAGAAGGCAGTGGG - Intergenic
1026711237 7:72741807-72741829 CATGGAGGCCAGAAGGCAGTGGG + Intronic
1029102725 7:98147063-98147085 CGTGGAGGCTAGAAGGCAGTGGG - Intronic
1032441644 7:131946681-131946703 GGAGGAGAGCAGAAGTCAGAGGG + Intergenic
1032689138 7:134265354-134265376 AGAGGTGAAAAGAAGGCAGATGG + Intergenic
1032989559 7:137377613-137377635 CATGGAGTCCAGAAGGCAGCAGG - Intergenic
1033562028 7:142541590-142541612 CTGGGAGACCAAAAGGCACACGG - Intergenic
1034392195 7:150795339-150795361 CAAAGAGGCCAGAAGGCATAGGG - Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1034886674 7:154803710-154803732 CCAGGAGAGGAGCAGGCAGAAGG + Intronic
1036159857 8:6377268-6377290 CTTGGAGGCCAGAAGGCAGTGGG + Intergenic
1036582993 8:10093931-10093953 CATGGAGACCAGAAAGCAGTGGG - Intronic
1036683499 8:10893218-10893240 GGAGCAGACCAGATGGGAGAAGG + Intergenic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037462260 8:19123124-19123146 GGAAGAGATCAGATGGCAGAAGG + Intergenic
1037624133 8:20592929-20592951 TGAGGAGACAAGCAGACAGATGG - Intergenic
1038387971 8:27167477-27167499 GGAGGAGACCTCAAAGCAGAAGG - Intergenic
1038542142 8:28398971-28398993 CGAGGACAGCAGAAGAAAGAAGG - Intronic
1038575532 8:28701229-28701251 CGAGAAGACCCGACCGCAGATGG - Intronic
1038744373 8:30244329-30244351 CATGGAGACCAGAAGGCACTGGG + Intergenic
1039360853 8:36874995-36875017 GGAGGAAACCAGGAAGCAGAAGG - Intronic
1039798688 8:40936273-40936295 GGAGGAGACCAGAAGTTAAAAGG + Intergenic
1040383942 8:46900666-46900688 GGAGGAGACCAGGAGGAAGGTGG + Intergenic
1041761586 8:61373118-61373140 CTAGGAGTCCAGAAGTCAAAGGG + Intronic
1043873212 8:85458190-85458212 CGGGGAGACCACATAGCAGATGG + Intergenic
1045146128 8:99346714-99346736 CAAGGATATCAGTAGGCAGAGGG - Intronic
1046783107 8:118236912-118236934 TGAGAAGACCAAAGGGCAGAAGG + Intronic
1046999299 8:120557571-120557593 AGAGGAGATCAGATGGCAAATGG - Intronic
1048356042 8:133654789-133654811 GAAGGAGCCCAGCAGGCAGAAGG + Intergenic
1048517048 8:135120695-135120717 CAAGGACATCAGAAGGCAGAAGG - Intergenic
1049181546 8:141225695-141225717 CCGGGAGACAAGAAGGCACAGGG + Intronic
1049229187 8:141473318-141473340 GGAGGGGCCCAGCAGGCAGACGG - Intergenic
1049371913 8:142272008-142272030 CGGGTAGACCAGAGGGCAGGCGG - Intronic
1049648691 8:143752293-143752315 CTTGGAGGCCAGAAGGCAGAGGG - Intergenic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1051061781 9:13053458-13053480 GGTGGAGACCAGAAGTAAGAAGG + Intergenic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1051106639 9:13587893-13587915 CAAGGAGACCAGAAGTGGGATGG - Intergenic
1051939222 9:22484767-22484789 CAAGGAGGGCATAAGGCAGAAGG + Intergenic
1052191737 9:25670563-25670585 CGAGGAGGGGAGAAGTCAGATGG - Intergenic
1052915511 9:33922191-33922213 GAAGAAGACCTGAAGGCAGATGG + Exonic
1053011673 9:34637275-34637297 CGAGGCGTGCAGAAGGCACATGG + Exonic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056437107 9:86585368-86585390 AGAGAAGACCAGAAGCCTGAGGG + Intergenic
1056587501 9:87938185-87938207 GGAAGCCACCAGAAGGCAGAAGG + Intergenic
1056992686 9:91425119-91425141 CAAGGAGACCAGGAGGGAGCTGG - Intergenic
1057176079 9:93000607-93000629 TTTGCAGACCAGAAGGCAGAGGG - Intronic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1058689790 9:107510065-107510087 CTAGGAGCCCAGAGGGCACAGGG + Intergenic
1060291539 9:122307385-122307407 AGAGGAGAGCAGAAGGCAATGGG - Intronic
1060807272 9:126585694-126585716 TGAGGACACCAGGAGGCAGCTGG + Intergenic
1061433347 9:130545024-130545046 CTAGGAGACAAAAAGGCAGGCGG + Intergenic
1061596703 9:131635174-131635196 CTAGGTGACCAGGAGGCAGTGGG - Intronic
1061881555 9:133571587-133571609 CGTGGGGCCCAGAAGGCAGAGGG - Intronic
1062547748 9:137071206-137071228 AGAGGAGAGCAAGAGGCAGAGGG - Intergenic
1186561599 X:10619123-10619145 CGAGGGGGCAAGAAGGCGGAGGG + Intronic
1186689832 X:11963653-11963675 CGAGTAGAACAGAAAGCTGAGGG + Intergenic
1188006691 X:25020752-25020774 GGAGGAGAGGAGAAAGCAGATGG - Intergenic
1189268875 X:39736470-39736492 GGAGGTGACCAGCAGGCAGAAGG + Intergenic
1189437481 X:41005890-41005912 TAAAGAGAGCAGAAGGCAGAAGG - Intergenic
1189622518 X:42857251-42857273 TGAGGGGAGCAGAAGCCAGATGG - Intergenic
1190469390 X:50762714-50762736 AATGGAGACCAGAAGGCAAAGGG - Intronic
1190990559 X:55545389-55545411 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1193492955 X:82171917-82171939 GGAGCTGACCAGAAGGTAGATGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195963958 X:110413457-110413479 CGAGGAGAGAAGTAGCCAGATGG - Intronic
1196006649 X:110843901-110843923 TGGGGAGGCCAGAAGGAAGATGG - Intergenic
1196258881 X:113554744-113554766 TGAGGAAGCCAGAAGGGAGATGG + Intergenic
1196732571 X:118955831-118955853 GGAGGAGACTAGAAGTCACAGGG - Intergenic
1198078246 X:133214614-133214636 TTAGGAGGCCAGAAGGCAAAAGG + Intergenic
1198321503 X:135521912-135521934 GGAGGGGACCAGGAGGAAGAGGG - Intronic
1198439273 X:136646171-136646193 GGAGGAGAGGAGAAGGGAGAAGG + Intergenic
1198444518 X:136698576-136698598 CTTGGAGGCCAGAAGGCAGTGGG + Intronic
1198581497 X:138069993-138070015 CATGGAGACCAGAAGACAGTGGG - Intergenic
1199580063 X:149351857-149351879 TGAGGAGGCCAGAAGGGAGATGG + Intergenic
1200532933 Y:4359442-4359464 CGAGGAGGGGAGAGGGCAGATGG + Intergenic
1200971644 Y:9158895-9158917 AGAGAAGTCCAGAATGCAGAAGG + Intergenic
1202139374 Y:21705398-21705420 AGAGAAGTCCAGAATGCAGAAGG - Intergenic