ID: 1125768117

View in Genome Browser
Species Human (GRCh38)
Location 15:42148517-42148539
Sequence CTGGGGAAAGGGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2078
Summary {0: 1, 1: 0, 2: 22, 3: 195, 4: 1860}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125768117_1125768129 24 Left 1125768117 15:42148517-42148539 CCCTCCACCTCCCCTTTCCCCAG 0: 1
1: 0
2: 22
3: 195
4: 1860
Right 1125768129 15:42148564-42148586 CACATGGATGAATGTCCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 185
1125768117_1125768128 23 Left 1125768117 15:42148517-42148539 CCCTCCACCTCCCCTTTCCCCAG 0: 1
1: 0
2: 22
3: 195
4: 1860
Right 1125768128 15:42148563-42148585 ACACATGGATGAATGTCCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 213
1125768117_1125768127 8 Left 1125768117 15:42148517-42148539 CCCTCCACCTCCCCTTTCCCCAG 0: 1
1: 0
2: 22
3: 195
4: 1860
Right 1125768127 15:42148548-42148570 ATGAAATCGATCTCTACACATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1125768117_1125768130 25 Left 1125768117 15:42148517-42148539 CCCTCCACCTCCCCTTTCCCCAG 0: 1
1: 0
2: 22
3: 195
4: 1860
Right 1125768130 15:42148565-42148587 ACATGGATGAATGTCCCCAGGGG 0: 1
1: 0
2: 3
3: 25
4: 218
1125768117_1125768131 30 Left 1125768117 15:42148517-42148539 CCCTCCACCTCCCCTTTCCCCAG 0: 1
1: 0
2: 22
3: 195
4: 1860
Right 1125768131 15:42148570-42148592 GATGAATGTCCCCAGGGGTGCGG 0: 1
1: 0
2: 0
3: 18
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125768117 Original CRISPR CTGGGGAAAGGGGAGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr