ID: 1125769110

View in Genome Browser
Species Human (GRCh38)
Location 15:42153381-42153403
Sequence ATTGTAGAGGCCATCATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769110_1125769114 0 Left 1125769110 15:42153381-42153403 CCCATCATGATGGCCTCTACAAT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1125769114 15:42153404-42153426 CATAATGTGACTGAAGCAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 141
1125769110_1125769117 24 Left 1125769110 15:42153381-42153403 CCCATCATGATGGCCTCTACAAT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1125769117 15:42153428-42153450 AGAGCATGAGGAACACAGCAGGG 0: 1
1: 0
2: 4
3: 38
4: 466
1125769110_1125769118 29 Left 1125769110 15:42153381-42153403 CCCATCATGATGGCCTCTACAAT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1125769118 15:42153433-42153455 ATGAGGAACACAGCAGGGTTTGG 0: 1
1: 0
2: 3
3: 27
4: 268
1125769110_1125769115 12 Left 1125769110 15:42153381-42153403 CCCATCATGATGGCCTCTACAAT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1125769115 15:42153416-42153438 GAAGCAGCGGGCAGAGCATGAGG 0: 1
1: 0
2: 3
3: 39
4: 558
1125769110_1125769116 23 Left 1125769110 15:42153381-42153403 CCCATCATGATGGCCTCTACAAT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1125769116 15:42153427-42153449 CAGAGCATGAGGAACACAGCAGG 0: 1
1: 0
2: 3
3: 25
4: 464
1125769110_1125769113 -1 Left 1125769110 15:42153381-42153403 CCCATCATGATGGCCTCTACAAT 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1125769113 15:42153403-42153425 TCATAATGTGACTGAAGCAGCGG 0: 1
1: 0
2: 0
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769110 Original CRISPR ATTGTAGAGGCCATCATGAT GGG (reversed) Intronic
902253483 1:15171616-15171638 ACTTTAGAGGTCATCATGATTGG - Intronic
912941122 1:114045741-114045763 AATATAGAGGCCATCAAGATTGG - Intergenic
918424172 1:184391675-184391697 ATTTGAGAGGACATCATGCTTGG - Intronic
920896954 1:210061190-210061212 ATTGTAGAGGATATTATGTTTGG + Intronic
1063507106 10:6609657-6609679 ATAGTAGGGGCCAGCATCATGGG - Intergenic
1073793464 10:106962825-106962847 ATTGAAGATGCCAGCATGTTGGG + Intronic
1076072556 10:127502602-127502624 ATGCAAGAGGACATCATGATGGG - Intergenic
1076234448 10:128852827-128852849 ATTGCAGAGTCTTTCATGATTGG + Intergenic
1076310114 10:129500132-129500154 ATTGGAAAGGCCATAAAGATTGG + Intronic
1079029857 11:16978449-16978471 ATTCTAAAGCCCATCATGGTTGG - Intronic
1081131292 11:39383402-39383424 ATTGGTTAGGCAATCATGATGGG + Intergenic
1084141973 11:67238273-67238295 ATTCTAGAGGCCACCAGGAAAGG - Intronic
1096467863 12:51857452-51857474 ATAGTAGAAGCCATTATGAGGGG - Intergenic
1098670683 12:73226132-73226154 ATTGTAGACGTCAACTTGATTGG - Intergenic
1099875651 12:88402621-88402643 ATTGTAAAGACCATCAGGCTAGG + Intergenic
1100722349 12:97372348-97372370 GCTGAAGAGGCCATCATGAGTGG + Intergenic
1100810370 12:98331280-98331302 ATTGTAGAGCCCAACATTAAGGG - Intergenic
1100837149 12:98577228-98577250 AATGTAGACGACAGCATGATGGG + Intergenic
1105650256 13:22369613-22369635 ATTGCAGAGGCCTTCATTTTGGG + Intergenic
1108127441 13:47259679-47259701 ATAGTAGAGGCAATCCTGAAAGG - Intergenic
1108385282 13:49893986-49894008 ATTCTAGAGCCCTTCATGAGAGG - Intergenic
1109270008 13:60245311-60245333 ATTAGTGAAGCCATCATGATTGG - Intergenic
1111491518 13:88982151-88982173 AATGTTGAGGCCATCTTGGTCGG + Intergenic
1112218621 13:97463288-97463310 ATTGTAGAGACAATCATCTTAGG + Intronic
1113175320 13:107557311-107557333 CTTGTAGAAGCAATCTTGATGGG + Intronic
1120302276 14:82723222-82723244 GTAAGAGAGGCCATCATGATAGG + Intergenic
1121302881 14:92885916-92885938 CATGTAGAGGACATCAAGATAGG + Intergenic
1123832595 15:24156379-24156401 ATTGTAAAGGCCATCAAGGCTGG - Intergenic
1125769110 15:42153381-42153403 ATTGTAGAGGCCATCATGATGGG - Intronic
1129485491 15:75867251-75867273 CTCATAGAGGCCATCAAGATAGG + Intronic
1131935160 15:97496001-97496023 ATTGTAGAGTAAATCATGATGGG + Intergenic
1138305890 16:55974040-55974062 ATAGTAAAGGCCATTTTGATAGG - Intergenic
1150911169 17:69389187-69389209 TTTGTAGCGGCCATCCTAATAGG + Intergenic
1153391220 18:4561937-4561959 ATTAAAGAGCCCAGCATGATAGG - Intergenic
1155805812 18:30169915-30169937 ATTGTATATGCCAACTTGATTGG - Intergenic
1159105127 18:63995991-63996013 GTTGCGTAGGCCATCATGATGGG + Intronic
1161272328 19:3396974-3396996 AAAGCAGTGGCCATCATGATCGG + Intronic
1163680809 19:18681288-18681310 ATTGTGCTGGCCATCAAGATTGG - Intergenic
1163975076 19:20843043-20843065 ATTGTAAAGACCATCAAGACTGG + Intronic
1166901915 19:46071031-46071053 ATTCTAGAGAGCATCATGAATGG - Intronic
927253980 2:21023670-21023692 ATTGGAGAGGTCATCAGGAAGGG - Exonic
939223963 2:139341132-139341154 ATTGGAGAAGGAATCATGATAGG - Intergenic
942366670 2:175235578-175235600 AGTGTGGAGGCCATGATGCTGGG - Intergenic
943072573 2:183158367-183158389 TTTGGAGAATCCATCATGATTGG + Exonic
943257947 2:185620457-185620479 GTTGAATAGGCAATCATGATGGG - Intergenic
945249169 2:207748996-207749018 ATTTTAGCTGCCATCATGGTAGG - Intronic
946615272 2:221502220-221502242 ATTTGAGAGGCGATCATGAAAGG - Intronic
947981861 2:234417466-234417488 ATTATAGATGACATAATGATGGG - Intergenic
948254941 2:236560333-236560355 TTTGTAAAGGCCATCCTGATAGG + Intergenic
1169019928 20:2322117-2322139 TTTGAACAGGCCTTCATGATCGG - Intronic
1169951527 20:11049579-11049601 ATAGAAGAGGCCAACTTGATAGG + Intergenic
1170151642 20:13232972-13232994 ATTGTAGTGACCATCATGGTGGG + Intronic
1178483700 21:33003623-33003645 ATTATAGTGGCCATCCTGCTGGG + Intergenic
1183614820 22:38937447-38937469 ACCGTAGAAGCCATCATGCTGGG + Intergenic
949678153 3:6481941-6481963 ATTATACAGGGCATCATGCTAGG - Intergenic
950253164 3:11483791-11483813 ACCGTAGAGTCCATCCTGATTGG - Intronic
950571633 3:13803837-13803859 AATGTAGTGGCCCACATGATGGG - Intergenic
951473138 3:23077759-23077781 TTTGTGGAGACCAGCATGATGGG - Intergenic
954202351 3:49031306-49031328 ACTGTAATGGCCATCATTATTGG - Intronic
955108708 3:55926349-55926371 AATGTAGAAGCCAGCATGCTAGG - Intronic
956221237 3:66906094-66906116 AATGTAGAGGACATGTTGATGGG - Intergenic
961350905 3:126301331-126301353 ATTGTAGAGGCTCTCCAGATTGG + Intergenic
967896763 3:194401676-194401698 AATGTAGAGGCCATTCTGACTGG - Intergenic
967946089 3:194805373-194805395 ATTTTAGAGGCAGTCTTGATAGG + Intergenic
969541814 4:7796310-7796332 ATTATATAGTCCATCATGCTTGG - Intronic
972419255 4:38870902-38870924 ACTGTGGATGCTATCATGATGGG - Intronic
972648943 4:40997063-40997085 GTTGGATAGGCAATCATGATAGG - Intronic
975950465 4:79763922-79763944 ATTCTTGAGGCAAGCATGATTGG + Intergenic
977276066 4:94978748-94978770 ATTGTAGTGGCCATCTGTATTGG + Intronic
979525133 4:121708263-121708285 AGTGAAGAGGCCACCATGACTGG + Intergenic
979681154 4:123461450-123461472 ATTATAGATGCCATCATGACTGG + Intergenic
985072760 4:186184473-186184495 ATTGTAAAGACCATCAGGCTAGG - Intergenic
987547436 5:19330792-19330814 ATTGTAGATGACATAATGAATGG - Intergenic
988284519 5:29194116-29194138 TTTGCAGAGGCCATTGTGATAGG + Intergenic
994361710 5:98858203-98858225 ATGGTAAAGACCATCGTGATTGG - Exonic
1001301817 5:170539046-170539068 ATTCTGGAGGCCATGATCATAGG - Intronic
1009607484 6:65892617-65892639 ATTGCAGAGGCCATCACTAGTGG + Intergenic
1009828729 6:68901429-68901451 ATTGCAGAGGTAATGATGATTGG - Intronic
1013029130 6:106313446-106313468 TTTCTAGAGGAAATCATGATTGG - Intronic
1015426828 6:133080274-133080296 AATGTAGAGGACTTCATGGTTGG - Intergenic
1016425263 6:143929272-143929294 TTTGTTGAGGGCATCATGATAGG + Intronic
1017395356 6:153992337-153992359 ATTGCAGAGGGTAACATGATGGG - Intergenic
1023787607 7:43723572-43723594 ATTTTAGAGTCTGTCATGATGGG + Intronic
1028526919 7:91797184-91797206 ACTGTAGAGGCCTACGTGATGGG - Intronic
1030703772 7:112669579-112669601 ATTCTATAGGCCAACTTGATTGG + Intergenic
1030970492 7:116049034-116049056 ATTGTAAAGACCATCATGCTAGG + Intronic
1032020113 7:128403029-128403051 ATTGTAGAGACCATAAGGATTGG - Intronic
1033835964 7:145312621-145312643 ATTCTAAAGGCCTTCAGGATTGG + Intergenic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1036876068 8:12474293-12474315 ATTGCAGAGGCCATTAAGGTTGG + Intergenic
1038121382 8:24620077-24620099 ATTCTAGATGCCATCATTTTAGG - Intergenic
1040034607 8:42858204-42858226 ATTATGGAGGACAACATGATTGG + Intronic
1041338085 8:56810667-56810689 ATTGTAAAGACCATCAAGCTAGG - Intergenic
1042220761 8:66471579-66471601 ATTGTAAGGGCCAGAATGATGGG - Intronic
1043562994 8:81516750-81516772 ATTGTTGAGGTCATGCTGATGGG - Intergenic
1046627009 8:116585826-116585848 AGTGTAGAGGCTCTCATGAGAGG - Intergenic
1047869564 8:129067805-129067827 ATGGTAGAGACCATCTGGATTGG + Intergenic
1051529382 9:18083375-18083397 ATTGAAGAAGTTATCATGATAGG + Intergenic
1052550567 9:29942173-29942195 TTTCCAGAGGCCAGCATGATGGG - Intergenic
1053521751 9:38787499-38787521 TTTGTAGTGACCATCCTGATGGG - Intergenic
1054193918 9:62011488-62011510 TTTGTAGTGACCATCCTGATGGG - Intergenic
1054330697 9:63752770-63752792 ATTGTAGTCACCAACATGATAGG - Intergenic
1054644489 9:67577203-67577225 TTTGTAGTGACCATCCTGATGGG + Intergenic
1059249390 9:112875245-112875267 AGTGTAGTAGCCATCATGACTGG + Intronic
1187060755 X:15785008-15785030 CTGATAGTGGCCATCATGATGGG - Exonic
1188473389 X:30564930-30564952 GTTCTAGAGTCCAACATGATGGG + Intronic
1192440700 X:71171373-71171395 ATTGGAGAGGCCTTCATGCAGGG - Intergenic
1192837148 X:74812343-74812365 AATGAAGAGGCCATCAAGCTAGG - Intronic
1194149854 X:90310166-90310188 ATTTCAGAGACCTTCATGATAGG - Intergenic
1194896341 X:99445877-99445899 ATTGCACATGTCATCATGATGGG - Intergenic
1195437947 X:104866973-104866995 ATTCTAGAAGCCAACATGACTGG + Intronic
1196232104 X:113235796-113235818 ATTGAAGAGGACACCAAGATTGG - Intergenic
1199976179 X:152896148-152896170 AAGGTAGAAGACATCATGATGGG - Intergenic
1200496283 Y:3887239-3887261 ATTTCAGAGACCTTCATGATAGG - Intergenic