ID: 1125769631

View in Genome Browser
Species Human (GRCh38)
Location 15:42156492-42156514
Sequence CAAGATGCTGCCCCTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769631_1125769646 28 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769631_1125769641 18 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213
1125769631_1125769635 -6 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769631_1125769639 14 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769639 15:42156529-42156551 TGGCCAGAGTGCCCAAAGCATGG 0: 1
1: 0
2: 3
3: 28
4: 244
1125769631_1125769645 27 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769645 15:42156542-42156564 CAAAGCATGGCTGGGCAGCCCGG 0: 1
1: 0
2: 2
3: 25
4: 376
1125769631_1125769642 19 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769642 15:42156534-42156556 AGAGTGCCCAAAGCATGGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769631 Original CRISPR CAAGATGCTGCCCCTCCTGG GGG (reversed) Exonic