ID: 1125769634

View in Genome Browser
Species Human (GRCh38)
Location 15:42156495-42156517
Sequence AGACAAGATGCTGCCCCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769634_1125769641 15 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213
1125769634_1125769635 -9 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769634_1125769639 11 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769639 15:42156529-42156551 TGGCCAGAGTGCCCAAAGCATGG 0: 1
1: 0
2: 3
3: 28
4: 244
1125769634_1125769645 24 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769645 15:42156542-42156564 CAAAGCATGGCTGGGCAGCCCGG 0: 1
1: 0
2: 2
3: 25
4: 376
1125769634_1125769642 16 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769642 15:42156534-42156556 AGAGTGCCCAAAGCATGGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 174
1125769634_1125769646 25 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769634 Original CRISPR AGACAAGATGCTGCCCCTCC TGG (reversed) Exonic