ID: 1125769635

View in Genome Browser
Species Human (GRCh38)
Location 15:42156509-42156531
Sequence ATCTTGTCTGCCAGCCACCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 334}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769633_1125769635 -8 Left 1125769633 15:42156494-42156516 CCCAGGAGGGGCAGCATCTTGTC 0: 1
1: 0
2: 2
3: 28
4: 200
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769626_1125769635 23 Left 1125769626 15:42156463-42156485 CCTCTTCTCTCTCTTCTGAAGCA 0: 1
1: 1
2: 4
3: 75
4: 549
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769634_1125769635 -9 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769624_1125769635 25 Left 1125769624 15:42156461-42156483 CCCCTCTTCTCTCTCTTCTGAAG 0: 1
1: 0
2: 4
3: 78
4: 766
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769632_1125769635 -7 Left 1125769632 15:42156493-42156515 CCCCAGGAGGGGCAGCATCTTGT 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769625_1125769635 24 Left 1125769625 15:42156462-42156484 CCCTCTTCTCTCTCTTCTGAAGC 0: 1
1: 1
2: 7
3: 43
4: 618
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334
1125769631_1125769635 -6 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769635 15:42156509-42156531 ATCTTGTCTGCCAGCCACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769635 Original CRISPR ATCTTGTCTGCCAGCCACCT TGG Exonic