ID: 1125769636

View in Genome Browser
Species Human (GRCh38)
Location 15:42156519-42156541
Sequence GGCACTCTGGCCAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 342}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769636_1125769647 11 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769647 15:42156553-42156575 TGGGCAGCCCGGGCCCCAGCAGG 0: 1
1: 0
2: 3
3: 53
4: 409
1125769636_1125769646 1 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769636_1125769645 0 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769645 15:42156542-42156564 CAAAGCATGGCTGGGCAGCCCGG 0: 1
1: 0
2: 2
3: 25
4: 376
1125769636_1125769648 12 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769648 15:42156554-42156576 GGGCAGCCCGGGCCCCAGCAGGG 0: 1
1: 0
2: 14
3: 53
4: 478
1125769636_1125769641 -9 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213
1125769636_1125769642 -8 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769642 15:42156534-42156556 AGAGTGCCCAAAGCATGGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769636 Original CRISPR GGCACTCTGGCCAAGGTGGC TGG (reversed) Exonic