ID: 1125769639

View in Genome Browser
Species Human (GRCh38)
Location 15:42156529-42156551
Sequence TGGCCAGAGTGCCCAAAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769632_1125769639 13 Left 1125769632 15:42156493-42156515 CCCCAGGAGGGGCAGCATCTTGT 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1125769639 15:42156529-42156551 TGGCCAGAGTGCCCAAAGCATGG 0: 1
1: 0
2: 3
3: 28
4: 244
1125769634_1125769639 11 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769639 15:42156529-42156551 TGGCCAGAGTGCCCAAAGCATGG 0: 1
1: 0
2: 3
3: 28
4: 244
1125769631_1125769639 14 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769639 15:42156529-42156551 TGGCCAGAGTGCCCAAAGCATGG 0: 1
1: 0
2: 3
3: 28
4: 244
1125769633_1125769639 12 Left 1125769633 15:42156494-42156516 CCCAGGAGGGGCAGCATCTTGTC 0: 1
1: 0
2: 2
3: 28
4: 200
Right 1125769639 15:42156529-42156551 TGGCCAGAGTGCCCAAAGCATGG 0: 1
1: 0
2: 3
3: 28
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769639 Original CRISPR TGGCCAGAGTGCCCAAAGCA TGG Exonic