ID: 1125769641

View in Genome Browser
Species Human (GRCh38)
Location 15:42156533-42156555
Sequence CAGAGTGCCCAAAGCATGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769634_1125769641 15 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213
1125769632_1125769641 17 Left 1125769632 15:42156493-42156515 CCCCAGGAGGGGCAGCATCTTGT 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213
1125769636_1125769641 -9 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213
1125769633_1125769641 16 Left 1125769633 15:42156494-42156516 CCCAGGAGGGGCAGCATCTTGTC 0: 1
1: 0
2: 2
3: 28
4: 200
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213
1125769631_1125769641 18 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769641 Original CRISPR CAGAGTGCCCAAAGCATGGC TGG Exonic