ID: 1125769646

View in Genome Browser
Species Human (GRCh38)
Location 15:42156543-42156565
Sequence AAAGCATGGCTGGGCAGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 325}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125769634_1125769646 25 Left 1125769634 15:42156495-42156517 CCAGGAGGGGCAGCATCTTGTCT 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769631_1125769646 28 Left 1125769631 15:42156492-42156514 CCCCCAGGAGGGGCAGCATCTTG 0: 1
1: 0
2: 4
3: 27
4: 247
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769632_1125769646 27 Left 1125769632 15:42156493-42156515 CCCCAGGAGGGGCAGCATCTTGT 0: 1
1: 0
2: 4
3: 18
4: 192
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769638_1125769646 -6 Left 1125769638 15:42156526-42156548 CCTTGGCCAGAGTGCCCAAAGCA 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769633_1125769646 26 Left 1125769633 15:42156494-42156516 CCCAGGAGGGGCAGCATCTTGTC 0: 1
1: 0
2: 2
3: 28
4: 200
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769636_1125769646 1 Left 1125769636 15:42156519-42156541 CCAGCCACCTTGGCCAGAGTGCC 0: 1
1: 0
2: 4
3: 36
4: 342
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325
1125769637_1125769646 -3 Left 1125769637 15:42156523-42156545 CCACCTTGGCCAGAGTGCCCAAA 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1125769646 15:42156543-42156565 AAAGCATGGCTGGGCAGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125769646 Original CRISPR AAAGCATGGCTGGGCAGCCC GGG Exonic