ID: 1125770163

View in Genome Browser
Species Human (GRCh38)
Location 15:42159873-42159895
Sequence CTCTGTGGGAACATGTATCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125770157_1125770163 12 Left 1125770157 15:42159838-42159860 CCTGAGTGTCTGGTGAGCGAAGA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1125770163 15:42159873-42159895 CTCTGTGGGAACATGTATCTAGG 0: 1
1: 0
2: 0
3: 17
4: 156
1125770155_1125770163 20 Left 1125770155 15:42159830-42159852 CCAGCCTGCCTGAGTGTCTGGTG 0: 1
1: 0
2: 0
3: 37
4: 324
Right 1125770163 15:42159873-42159895 CTCTGTGGGAACATGTATCTAGG 0: 1
1: 0
2: 0
3: 17
4: 156
1125770156_1125770163 16 Left 1125770156 15:42159834-42159856 CCTGCCTGAGTGTCTGGTGAGCG 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1125770163 15:42159873-42159895 CTCTGTGGGAACATGTATCTAGG 0: 1
1: 0
2: 0
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125770163 Original CRISPR CTCTGTGGGAACATGTATCT AGG Exonic
902839551 1:19066369-19066391 CCATGTGGGAACCTGTGTCTGGG + Intergenic
903201829 1:21746933-21746955 CTCTCTGGGAACCTCTGTCTGGG - Intronic
906663668 1:47601862-47601884 CTCTGTGGCAACCTTTCTCTGGG - Intergenic
907268210 1:53275509-53275531 CTCTGGGGGAAAATGCATCTTGG + Intronic
909925482 1:81432955-81432977 GTCTGTGGAAATATGTACCTTGG + Intronic
912126816 1:106549708-106549730 CTCTCTGGGAACTTTTATCAGGG + Intergenic
915604836 1:156943926-156943948 CTCTGTGGCCACAGGTACCTGGG - Exonic
917108628 1:171521408-171521430 CTCTGTAGGAACTTGGCTCTGGG - Intronic
921088850 1:211823594-211823616 ATCTGTGGGAACAGGTACCCTGG - Intronic
921313312 1:213867178-213867200 CTATGTGGCAACATGAATCAGGG - Intergenic
921895116 1:220391660-220391682 CTCTTTGAAAACATGTTTCTGGG + Intergenic
922737849 1:227998977-227998999 TTATGTGGGAACATGGTTCTAGG - Intergenic
1072565846 10:96616022-96616044 CTCTGTGGGAAGATGCATTGTGG + Intronic
1075327574 10:121546877-121546899 CTTTCTGGAAAAATGTATCTTGG + Intronic
1076535835 10:131176285-131176307 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535844 10:131176491-131176513 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535859 10:131176767-131176789 CTCTGTGTGTCCATGTGTCTTGG - Intronic
1076535864 10:131176945-131176967 CTCTGTGTGTACACGTGTCTTGG - Intronic
1076782750 10:132733262-132733284 CTCTGGGTGAACATGAATCTGGG + Intronic
1076987188 11:246652-246674 TGCTGAGGGAGCATGTATCTGGG - Intronic
1080773413 11:35363525-35363547 CCCTGGGGGAACTTGTATCCTGG - Intronic
1083313317 11:61797649-61797671 CTCTATGGGAAACAGTATCTTGG - Intronic
1086311650 11:85542080-85542102 CTCTGTGGGCACACGAATGTGGG - Intronic
1088126430 11:106430506-106430528 CTCTGTGTGTATATGTAACTTGG - Intergenic
1094751888 12:33418997-33419019 CTTGGTGGGAACATGTAGCACGG + Intronic
1095679607 12:44958757-44958779 ATCTGGGGGAAGATGGATCTAGG + Intergenic
1101305028 12:103519776-103519798 ATCTGTGGGGAGATGTATGTGGG - Intergenic
1103678502 12:122675598-122675620 CTCTGTGGGCTCCTGTGTCTGGG + Intergenic
1103719579 12:122966169-122966191 CTCGGTGGGAATAGGCATCTCGG - Intronic
1104575613 12:129963523-129963545 CTATGTGGGAAAATGTGCCTAGG + Intergenic
1104727343 12:131086104-131086126 CTCTGTGGTCACATTTATCAAGG + Intronic
1105023584 12:132834186-132834208 CTCTTTGACAACATGAATCTGGG + Intronic
1106614347 13:31313251-31313273 CTCTGTGAGAAAAGATATCTTGG + Intronic
1108054829 13:46475145-46475167 CTCTGTGGGACTTTGTCTCTGGG + Intergenic
1110483833 13:76015186-76015208 CTCTGTGGGATCACGTAACTGGG - Intergenic
1112674463 13:101683267-101683289 CTGTTTGGGAATATATATCTAGG - Intronic
1112754528 13:102616533-102616555 CTCTATGGGAATATGGTTCTAGG - Intronic
1113568600 13:111337577-111337599 CAGTGTGGGAACATCTATCTAGG + Intronic
1113811087 13:113143118-113143140 CTCTGTGGCCACACGTGTCTGGG - Intronic
1115662051 14:35506070-35506092 CTCTGTGGGAAAATCCATATGGG - Intergenic
1117013514 14:51494631-51494653 ACCTGTGGCAACATCTATCTAGG + Intronic
1120730493 14:87995610-87995632 CTCTGTGGGAACTTGCATGGGGG - Intergenic
1125627366 15:41119622-41119644 CTTTGTGCTAAAATGTATCTTGG - Intergenic
1125770163 15:42159873-42159895 CTCTGTGGGAACATGTATCTAGG + Exonic
1125975008 15:43943487-43943509 TTCTGTGTGAACATGAATTTTGG - Intronic
1127824808 15:62693554-62693576 CTCTGTGGGAACTTGGATTGAGG + Intronic
1128239386 15:66091173-66091195 ATCTGTGGAGACAAGTATCTTGG - Intronic
1129114148 15:73355829-73355851 GCCTGAGGGAACATGCATCTGGG - Intronic
1129686727 15:77690343-77690365 TTCTGTGGTAACATGCTTCTAGG - Intronic
1130106006 15:80928966-80928988 CTCTGTGGGATCTTGTCTCTGGG + Intronic
1130762539 15:86835219-86835241 CTCGCTGGGATCATATATCTAGG + Intronic
1130900467 15:88203126-88203148 CACTGTGGGAAACTGGATCTGGG - Intronic
1131919629 15:97310003-97310025 CTCCATGGGAACATGTGCCTGGG - Intergenic
1132025773 15:98403398-98403420 CTCTGTGGGGCCACGTGTCTTGG - Intergenic
1134759131 16:16698078-16698100 ATCTGAGGAAACATTTATCTTGG + Intergenic
1134986943 16:18661106-18661128 ATCTGAGGAAACATTTATCTTGG - Intergenic
1138594837 16:58024500-58024522 CTCTGTGGGATCCTTCATCTGGG - Intergenic
1140838940 16:78821075-78821097 TTCTGAGTGAACATGTTTCTAGG + Intronic
1141450972 16:84101719-84101741 CTCTGTGGGAAGAAACATCTGGG - Exonic
1141553354 16:84820776-84820798 GTCTGGGGGAACACGTTTCTGGG + Intronic
1142564042 17:827938-827960 GTCTGTGGAGACCTGTATCTTGG + Intronic
1143805977 17:9427175-9427197 TTCTATGGGAACATGTATTTGGG - Intronic
1145260676 17:21352635-21352657 CTCTGTGGGCACAAAGATCTGGG - Intergenic
1146141421 17:30371300-30371322 CTTTGTGGGAAGATTTACCTTGG - Intergenic
1149374813 17:56033286-56033308 TTCTGTGGGGGAATGTATCTTGG - Intergenic
1150137455 17:62703724-62703746 CTCTGTGGGACCATTTGCCTCGG + Intronic
1152304204 17:79511770-79511792 CCCGATGGTAACATGTATCTGGG - Intronic
1152304269 17:79512020-79512042 CTCGATGGTAACATGTATCCAGG - Intronic
1152304291 17:79512120-79512142 CCCAATGGTAACATGTATCTGGG - Intronic
1152304319 17:79512220-79512242 CTCGATGGTAACATGTATCCGGG - Intronic
1152304371 17:79512420-79512442 CTCGATGGTAACATGTATCCAGG - Intronic
1152304393 17:79512520-79512542 CCCGATGGTAACATGTATCTGGG - Intronic
1152304408 17:79512570-79512592 CCCGATGGTAACATGTATCTGGG - Intronic
1152304526 17:79512970-79512992 CCCGATGGTAACATGTATCTGGG - Intronic
1152304565 17:79513120-79513142 CTTGATGGTAACATGTATCTGGG - Intronic
1152304608 17:79513320-79513342 CCTGGTGGTAACATGTATCTGGG - Intronic
1152390294 17:80000222-80000244 TTCTGTGTGGACATGAATCTTGG - Intronic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1156195290 18:34768013-34768035 TTCTGTGGGAACATTTTCCTTGG - Intronic
1161228146 19:3157490-3157512 CTCTGGGGGGACATGAATTTCGG + Intronic
1162769463 19:12940418-12940440 GTCTGTGGGATCATCGATCTTGG - Exonic
1164634526 19:29782477-29782499 CTCTGTGGGAACGAGTATTTAGG + Intergenic
1168264754 19:55216687-55216709 CTCAGTGCGAGCATGGATCTAGG - Intergenic
925112569 2:1348691-1348713 CACCTTGGGAACATGTTTCTAGG + Intronic
925501791 2:4513056-4513078 CTCAGGGGGAAGATGTATGTGGG + Intergenic
925806723 2:7658272-7658294 CTCTCTGGGAACATATAGATGGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930956285 2:57206640-57206662 CTCTGTGGGACCAGCTGTCTTGG - Intergenic
931490229 2:62737453-62737475 CTCTGTGGGAACCAGTACTTGGG - Intronic
932124181 2:69128495-69128517 CTCTGAGACAACATGTATCCGGG + Intronic
932784026 2:74583787-74583809 CTGTGTTGGAACAAGTATGTTGG - Intronic
933252298 2:80042616-80042638 CTCTGTGGGAAAATGGACCATGG + Intronic
935035464 2:99367885-99367907 TTCTGTGTGAACATTTCTCTTGG - Intronic
937529074 2:122806951-122806973 TTCTGAGTGAACATGTATTTTGG + Intergenic
937716258 2:125037263-125037285 CTCTGTGGGAGCACCTCTCTGGG + Intergenic
939949215 2:148448380-148448402 CTGTGTCTGAATATGTATCTAGG - Intronic
939960982 2:148565507-148565529 CTCTGTAGGAACTAGGATCTGGG + Intergenic
941476651 2:165957499-165957521 CACTGTGGGAGCCTGTCTCTGGG - Intergenic
943101840 2:183496403-183496425 CACTATGAGAACCTGTATCTTGG - Intergenic
944299134 2:198102573-198102595 CTCTGTGGGAACTTGCCTCCAGG - Intronic
946131064 2:217607260-217607282 CTCTGTGAGAACATGCAGCTAGG - Intronic
947114950 2:226759846-226759868 CTCTGTTGGAACTTGTACATAGG + Intronic
1170643103 20:18173304-18173326 CTCTGTGGGAACCAGCATCAAGG - Intronic
1177956021 21:27600437-27600459 CACTGTCTGCACATGTATCTTGG - Intergenic
1179307403 21:40167479-40167501 CTCTTTGGAAACATGAATCTTGG + Intronic
950131303 3:10548606-10548628 CACTGTGGGCACCTGGATCTGGG - Intronic
953392549 3:42542043-42542065 TTCTGTGGGAACATGATGCTTGG - Intergenic
955873059 3:63460297-63460319 CTCTGTGGGAGGATGGATCCTGG - Intronic
962295568 3:134181644-134181666 CTCTGTTGGAAGATGTTTATAGG - Intronic
962874410 3:139524830-139524852 ATCTGTTGGCACATGTCTCTGGG - Intronic
970446308 4:16125918-16125940 CTCTGTGGAAACAGGTGTGTTGG + Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
971175530 4:24278952-24278974 TGCTGTGGGAAAACGTATCTAGG - Intergenic
971235738 4:24840498-24840520 CTCCGTGGGAACGTGTGTGTCGG - Intronic
973045335 4:45530385-45530407 CACTGTGGGAGCACGTCTCTGGG + Intergenic
975180616 4:71339843-71339865 CACTGTGGAAACATATCTCTTGG - Intronic
978570772 4:110134517-110134539 CTCTGGGGGGACATGTATTGTGG + Intronic
979351251 4:119646681-119646703 CTCGATGGGACCATATATCTTGG - Intergenic
980056994 4:128087219-128087241 CCCTGTGAAAAAATGTATCTGGG - Intronic
980470287 4:133240839-133240861 CACTGTGGGAACCCGTTTCTGGG - Intergenic
982508664 4:156252345-156252367 CTATTTGGGAACATGTAGGTGGG + Intergenic
983970250 4:173862975-173862997 TTCTGTGGGAGCAGGTTTCTGGG + Intergenic
984321222 4:178198894-178198916 CTCTGTGGGAACCAGTGCCTTGG + Intergenic
989645376 5:43626299-43626321 CTATTTGGGAAGATGTATGTAGG + Intronic
989819287 5:45775753-45775775 CTCTGTGAGTACATGTATATGGG - Intergenic
990225665 5:53649504-53649526 CTCTGTGGCAACATGGATGAAGG - Intronic
994129127 5:96204506-96204528 TTCTGTGGGAACTTGTAGCCTGG - Intergenic
995637260 5:114207827-114207849 CTCTGTGCCAACATGTCTCTCGG - Intergenic
995988495 5:118208378-118208400 CACTGTGGGAGCCTGTCTCTGGG - Intergenic
996388230 5:122932307-122932329 CTCTGAGGAAAGATGTCTCTAGG + Intronic
997098819 5:130945199-130945221 CTCTGAAAGAAAATGTATCTAGG + Intergenic
997271374 5:132541079-132541101 CAGTGTGGGAACCTGTAACTAGG - Intergenic
1001494327 5:172177289-172177311 CTCTGTGGGAGCCTTGATCTTGG + Intronic
1001999338 5:176188873-176188895 CTCTATTGGAACATGTATGCTGG + Intergenic
1002534048 5:179866402-179866424 CTGCGTGGGAACATGCACCTGGG + Intronic
1002688258 5:181032407-181032429 CGCTGTGGGAGCCTGTCTCTGGG + Intergenic
1008284401 6:49629979-49630001 CACTGTGGGAACCTCTTTCTGGG - Intronic
1008594636 6:53029014-53029036 CTTTCTGGCAACAAGTATCTGGG + Intronic
1015272294 6:131349452-131349474 CTCTCTGGGCCCATGTACCTAGG - Intergenic
1018656502 6:166041945-166041967 CTGTGTGGAAACGTGTTTCTAGG + Intergenic
1018765590 6:166930541-166930563 CTCTGTGTGAACATGCATGTGGG - Intronic
1022593186 7:31686140-31686162 TTCTGTGAGAACATATTTCTTGG + Intergenic
1023173434 7:37412398-37412420 TTCTGTGGTAAGATGTCTCTTGG + Intronic
1028535324 7:91885475-91885497 CTCTATGGGTATATGTATATAGG - Intergenic
1031409156 7:121421639-121421661 CACTGTGGGAACCTGTTTCTGGG + Intergenic
1035907031 8:3523542-3523564 ATCTGTGTGCACATGTGTCTGGG - Intronic
1036180591 8:6581070-6581092 CTATGTGGGAAGATGTGCCTAGG + Intronic
1036641701 8:10588680-10588702 CTCTGCGGGAACATGTCTTAGGG + Intergenic
1040531000 8:48266253-48266275 GTTTGTGGGAACATGTACCTAGG - Intergenic
1043059700 8:75484580-75484602 TTTTGTGAGAACATGTAACTGGG - Intronic
1044280092 8:90344311-90344333 GTCTGTGGGAGCATGTGACTTGG + Intergenic
1048452391 8:134544939-134544961 CTCTGTGGGTGTATGTATCTTGG + Intronic
1048843884 8:138588542-138588564 CTTTGTGGGATCATATGTCTTGG - Exonic
1050291321 9:4158315-4158337 CTCTTTGGACACATGTATCAGGG - Intronic
1050583852 9:7089666-7089688 GTTTATGGGAACATGTAACTTGG - Intergenic
1056798354 9:89674415-89674437 CACTGAGGGAACGTGTATCCTGG - Intergenic
1056904167 9:90631181-90631203 CTCTGTGGAAACCTGTGTGTGGG + Intronic
1058825234 9:108769731-108769753 TTCTGTAGGAAAATGCATCTTGG - Intergenic
1060015749 9:120084839-120084861 CTCTGTGGGGACATCAATGTGGG - Intergenic
1061896687 9:133652015-133652037 CCCTCTGGGAACATCAATCTTGG + Intronic
1188777788 X:34242919-34242941 CCTTGTGAGAACATGTATGTTGG + Intergenic
1188977513 X:36692731-36692753 CTCTGTGGGATCCTATTTCTGGG - Intergenic
1190010203 X:46777898-46777920 TTGTGTGGGAACTTGTATCAGGG + Intergenic
1191008846 X:55739563-55739585 CTCAGTGGGAATGTGTATCAAGG + Intronic
1191732345 X:64350807-64350829 CTCTTTGGAAATATGTATTTTGG - Intronic
1192428524 X:71097276-71097298 CTCTGTGGGAATAAGTGTTTGGG - Intronic
1194904527 X:99558201-99558223 CTCTGTGAGCACATGTGCCTTGG - Intergenic
1195262278 X:103144214-103144236 CCCTGTGGGAAAATGGATTTGGG + Intergenic
1196143682 X:112293810-112293832 CTCTGTGCTAAAATGTAACTTGG + Intergenic
1196747545 X:119085264-119085286 CTCTTTGGGAACATTAATCAAGG - Intronic
1199394074 X:147313117-147313139 CTCTGTCGTAACATGTATGACGG + Intergenic
1199408288 X:147488327-147488349 ATCTGGTGGAGCATGTATCTTGG - Intergenic