ID: 1125770672

View in Genome Browser
Species Human (GRCh38)
Location 15:42163580-42163602
Sequence CTCCTAAGCAGTCTAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125770672_1125770678 -9 Left 1125770672 15:42163580-42163602 CCTGCTTTTAGACTGCTTAGGAG 0: 1
1: 0
2: 0
3: 12
4: 92
Right 1125770678 15:42163594-42163616 GCTTAGGAGGTGGGATGTTGGGG 0: 1
1: 0
2: 2
3: 25
4: 308
1125770672_1125770677 -10 Left 1125770672 15:42163580-42163602 CCTGCTTTTAGACTGCTTAGGAG 0: 1
1: 0
2: 0
3: 12
4: 92
Right 1125770677 15:42163593-42163615 TGCTTAGGAGGTGGGATGTTGGG 0: 1
1: 0
2: 3
3: 22
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125770672 Original CRISPR CTCCTAAGCAGTCTAAAAGC AGG (reversed) Intronic
907091265 1:51728564-51728586 CCCCTACCCACTCTAAAAGCTGG - Intronic
907558961 1:55370773-55370795 CTCCTAAAGAGTCAAATAGCTGG - Intergenic
911420421 1:97633978-97634000 CCCCTTATCTGTCTAAAAGCAGG - Intronic
915602918 1:156933479-156933501 CTCCAAAGCAGTCAAACACCTGG - Intergenic
917672725 1:177288367-177288389 CACCTAAGTAGTCTAAAGTCTGG - Intergenic
918108776 1:181437494-181437516 CTCCTAACCACTCTAACAGGTGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921327742 1:214004214-214004236 CTCCTCAGCAGACTCAGAGCTGG - Intronic
922852320 1:228743655-228743677 AGCCAAAGAAGTCTAAAAGCAGG + Exonic
923462998 1:234223324-234223346 CTCTGAAGCAGTCTGAGAGCTGG - Intronic
1065042005 10:21706650-21706672 CTCCTAGGCAGTTTGAAAGTGGG + Intronic
1066517457 10:36178854-36178876 ATCTTAAGCTTTCTAAAAGCAGG + Intergenic
1069782766 10:70967214-70967236 CTCATAATCAGTCTAAAAAGGGG - Intergenic
1073582309 10:104679970-104679992 CTCCCATGCAGTCTCACAGCAGG - Intronic
1073718763 10:106140753-106140775 CACCTCAGCTGTCTATAAGCAGG - Intergenic
1075318690 10:121472143-121472165 CTCATAAGCAGTACAAAGGCGGG + Intergenic
1079630170 11:22665564-22665586 CTCCTTAGCTTTCTAAAAGAAGG - Intronic
1081203829 11:40251107-40251129 TTCCTAAGCAGTCAGAAAGGAGG + Intronic
1088272255 11:108045744-108045766 CTCCTCAGCCTTCTAAGAGCTGG - Intronic
1089241813 11:117087672-117087694 CTCCTGAGCAGTGTATGAGCAGG - Intronic
1092601655 12:10072770-10072792 CTTATAAGCAGTTCAAAAGCAGG + Intronic
1092989988 12:13887613-13887635 CCCCAAAGCATTCTAAAAGCAGG - Intronic
1094332396 12:29308816-29308838 CTCCTAAGGAGGCTGAAATCAGG + Intronic
1094706289 12:32917194-32917216 CTCCTTTGAAGTCTGAAAGCAGG + Intergenic
1100088514 12:90940032-90940054 GCCCTGAGCAGTCAAAAAGCAGG - Intronic
1110009994 13:70320478-70320500 TTCCTAAGTGGTCTAAAAGGGGG - Intergenic
1112000615 13:95206237-95206259 TGTCTAAGCTGTCTAAAAGCAGG - Intronic
1114038318 14:18650561-18650583 CTCCTAAGGAGGCTAAAGTCAGG + Intergenic
1114120303 14:19664483-19664505 CTCCTAAGGAGGCTAAAGTCAGG - Intergenic
1118678608 14:68215727-68215749 GTGCTAAGCAGTCTAAAGACAGG - Intronic
1119344459 14:73911181-73911203 CTGCTTAACAGTTTAAAAGCTGG + Intronic
1122950870 14:105043887-105043909 CTCCTTGGCAGGTTAAAAGCTGG - Intergenic
1125394510 15:39232395-39232417 CCCTTAATCAGTCTAACAGCAGG + Intergenic
1125770672 15:42163580-42163602 CTCCTAAGCAGTCTAAAAGCAGG - Intronic
1131986092 15:98044022-98044044 CTCCTGAGCATCCTGAAAGCTGG - Intergenic
1134502806 16:14782452-14782474 CTCCTGAGCCGTACAAAAGCAGG + Intronic
1134577757 16:15346443-15346465 CTCCTGAGCCGTACAAAAGCAGG - Intergenic
1134724832 16:16411104-16411126 CTCCTGAGCCGTACAAAAGCAGG + Intergenic
1136655180 16:31705386-31705408 CTCCTGAGCAGTCTCAAATGTGG - Intergenic
1137405670 16:48187361-48187383 CTGCGAAGCAGTTCAAAAGCCGG + Exonic
1149072669 17:52561511-52561533 CTCATAAGAAGCCTAGAAGCTGG + Intergenic
1150814331 17:68380743-68380765 CTCCCAAGCAGTTGAAAATCTGG - Intronic
1152623680 17:81378917-81378939 CTCCCAGGCAGTCTGAACGCTGG + Intergenic
1153899059 18:9599387-9599409 CACCTAAGTAATCTAAAAGAAGG + Intronic
1154955251 18:21247578-21247600 CTCCTAAGCACACAAAAAGTTGG - Intronic
1158259954 18:55595599-55595621 CTCCCAAACCATCTAAAAGCAGG - Intronic
1159051867 18:63427754-63427776 CTCCTTATCAGTCCACAAGCTGG - Intergenic
1166241717 19:41499255-41499277 CCCCAAAGCATTCTAAAAACGGG + Intergenic
927449916 2:23199763-23199785 CCCCGAATCTGTCTAAAAGCAGG + Intergenic
929560037 2:42950826-42950848 CTACTAAGAAGTCTAGAGGCAGG - Intergenic
931385997 2:61797893-61797915 TTTTTAAGGAGTCTAAAAGCAGG + Intergenic
936438854 2:112532772-112532794 CTCATAGGCCGTATAAAAGCAGG + Exonic
938272646 2:129988537-129988559 CTCCTAAGGAGGCTAAAGTCAGG - Intergenic
938277537 2:130039515-130039537 CTCCTAAGGAGGCTAAAATCAGG - Intergenic
938328503 2:130430318-130430340 CTCCTAAGGAGGCTAAAATCAGG - Intergenic
938361443 2:130691176-130691198 CTCCTAAGGAGGCTAAAATCAGG + Intergenic
938437849 2:131297865-131297887 CTCCTAAGGAGGCTAAAATCAGG + Intronic
938443591 2:131357579-131357601 CTCCTAAGGAGGCTAAAATCAGG + Intergenic
1172872451 20:38144162-38144184 CTCCTCATCAGTCTAACAGGAGG + Intronic
1174274739 20:49395614-49395636 CTTCAGAGCAGTCTAGAAGCAGG - Intronic
1177356415 21:20014109-20014131 CTCCTAAGCAGAAAAAAAGATGG + Intergenic
1180462440 22:15577602-15577624 CTCCTAAGGAGGCTAAAGTCAGG + Intergenic
1180630827 22:17228706-17228728 CTCCTTATCAGCCAAAAAGCAGG - Intergenic
1183003453 22:34880535-34880557 CTCCTAAGCAGTCACAGAGATGG + Intergenic
958437597 3:94116500-94116522 CTGATAAGCAGTCTATATGCAGG - Intronic
959845402 3:111026989-111027011 CTCAAAAGCTGTATAAAAGCAGG - Intergenic
960159554 3:114335226-114335248 ATCCTAAGAAGTCTTAAATCTGG + Intergenic
961054223 3:123774263-123774285 CTCCTAAGCAACCTACAAGCAGG + Intronic
962929577 3:140023982-140024004 CTTCTAAGCAGTCAACAAGGAGG + Intronic
963149373 3:142029090-142029112 CTCCAAAGCAGTCACAAAGCAGG + Intronic
972553901 4:40161960-40161982 CTCTTAACCATTCTCAAAGCTGG + Intergenic
972801521 4:42480926-42480948 TTACTAGACAGTCTAAAAGCTGG + Intronic
972916762 4:43891208-43891230 CTCTGAAGCAGGCTAAAAGCAGG + Intergenic
977249625 4:94675361-94675383 CTCCTCTGGAGTCTAAAATCAGG + Intergenic
983396433 4:167203506-167203528 CTCCTAAGCAGTCTCATCTCAGG - Intronic
984396679 4:179210766-179210788 CTCATTAGCTGTCAAAAAGCAGG + Intergenic
987743808 5:21944859-21944881 CACCTAACCAGTCTACAAGAAGG + Intronic
997513541 5:134468899-134468921 CTCGTATGCAGTGTAAAAGCAGG + Intergenic
998423783 5:142010465-142010487 CTCATAAGCTGTATAAAAACAGG - Intronic
1001178926 5:169500198-169500220 GTCCTAAGCAGGCTAAAGGAAGG - Intergenic
1001210839 5:169808801-169808823 CTGCTTAGCAGTCTTAAAGTGGG + Intronic
1001886954 5:175301290-175301312 GTCCTAAGCAGAGAAAAAGCAGG + Intergenic
1003494874 6:6654918-6654940 CTCCTAAAAAGTTGAAAAGCAGG - Exonic
1004168511 6:13277319-13277341 CTCCTAAAGAGTCTACATGCAGG + Intronic
1005350628 6:24931438-24931460 CTCTTAAGGAGACTAACAGCTGG - Intronic
1008239685 6:49094328-49094350 CACAAAAGCAGTATAAAAGCAGG + Intergenic
1012371875 6:98517163-98517185 CTCCAAAGCAGGCTTAAACCTGG + Intergenic
1019124681 6:169830407-169830429 GTCCTAAGCACTTGAAAAGCAGG - Intergenic
1027564327 7:79771585-79771607 TTCCTAATTAGTATAAAAGCTGG - Intergenic
1032281749 7:130508794-130508816 CTCAAAAGCAGCCTACAAGCGGG + Intronic
1038150663 8:24940522-24940544 CTCCTGTGCAGACTAAAAGCAGG - Intergenic
1043077803 8:75723652-75723674 CTCATGAGCAGTCAAAAATCTGG - Intergenic
1044399847 8:91757996-91758018 CTCCTAGGCAGACAAAAAGCAGG - Intergenic
1044703676 8:94987639-94987661 CCCCTAAGCAGCCTAAAACTAGG - Intronic
1047155173 8:122308948-122308970 GTCCTAAGCAGGGTAATAGCAGG + Intergenic
1047164254 8:122419383-122419405 TTCCTCAGCAATATAAAAGCAGG + Intergenic
1049466930 8:142755700-142755722 CTCCACACCAGTTTAAAAGCAGG - Intergenic
1055915225 9:81393806-81393828 CTCCAAAGCAGTTTACAAACTGG + Intergenic
1060473374 9:123967186-123967208 CTGCTAAGCACCCTAAAGGCAGG + Intergenic
1185674691 X:1839745-1839767 TTCCTAAGAAGACTAAAAGATGG + Intergenic
1188863837 X:35289938-35289960 CACCTAATCAGACTGAAAGCTGG + Intergenic
1194008210 X:88523767-88523789 CTCCTAAGAAGTTGAACAGCCGG + Intergenic
1196197573 X:112852026-112852048 CTCGAAAGCAGTCTGGAAGCTGG - Intergenic
1201277728 Y:12314245-12314267 CTCCTGAACAGGATAAAAGCAGG + Intergenic
1201357617 Y:13113552-13113574 CTCCTGAACAGGATAAAAGCAGG + Intergenic