ID: 1125772482

View in Genome Browser
Species Human (GRCh38)
Location 15:42179118-42179140
Sequence ATCCAGTTCTTTGGGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125772482_1125772487 19 Left 1125772482 15:42179118-42179140 CCTTATTCCCCAAAGAACTGGAT 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1125772487 15:42179160-42179182 TTTTCATCAGTCACAAAGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 215
1125772482_1125772488 30 Left 1125772482 15:42179118-42179140 CCTTATTCCCCAAAGAACTGGAT 0: 1
1: 0
2: 1
3: 17
4: 220
Right 1125772488 15:42179171-42179193 CACAAAGCCAGGCCAGACAAAGG 0: 1
1: 0
2: 9
3: 32
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125772482 Original CRISPR ATCCAGTTCTTTGGGGAATA AGG (reversed) Intronic
903361057 1:22777559-22777581 ATTCTGTTCTCTGGGGAATCTGG - Intronic
904747822 1:32721662-32721684 AGTGAGTTCTTTGGGCAATAAGG - Intergenic
905081496 1:35325267-35325289 TTACAGCTCCTTGGGGAATAGGG + Intronic
906823778 1:48956736-48956758 AGCAAGTTCTTTGAGGAAAAGGG - Intronic
906971828 1:50523256-50523278 TTTCAGTTCTTTTGGGTATATGG + Intronic
907265819 1:53260266-53260288 CTCAAGTTCTTTGTGAAATAAGG - Intronic
907564560 1:55422761-55422783 TTCCTGTGCTTTGGGGAATTAGG + Intergenic
907684594 1:56597788-56597810 ATACATTACTTTGGGCAATATGG + Intronic
907702301 1:56801027-56801049 ATAGAGGTCTGTGGGGAATAAGG - Intronic
908133249 1:61098946-61098968 ACACAGTTCTTTGGAGAATGAGG + Intronic
908321877 1:62986501-62986523 ATCCAGTTTATTTGGGAAAAGGG + Intergenic
908349311 1:63268659-63268681 AGACAGTTCTTTTTGGAATACGG - Intergenic
910578240 1:88791791-88791813 ATCCAGATATTTAGGGAAAATGG + Intronic
911258060 1:95655069-95655091 GTCCAGTGCTTTGGAGATTATGG + Intergenic
917098648 1:171424566-171424588 ATCAAGTTCCTTTGGGAATGGGG - Intergenic
919368438 1:196695581-196695603 ATCAACTACTTTGGGCAATATGG + Intronic
920895351 1:210042928-210042950 ATCAATTACTTTGGGCAATATGG + Intronic
921261791 1:213390917-213390939 ATCCAGTTGTTTGAGAAGTATGG - Intergenic
921934014 1:220779397-220779419 CTCCATTTCTTTGGGTAAAATGG + Intronic
1063541513 10:6938848-6938870 AACCAGTTCTTGGGGGCAGAAGG - Intergenic
1063938884 10:11107314-11107336 ATCCAGTTCTCTGAAGAATTTGG - Intronic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1071306684 10:84305454-84305476 ATCCAGTTGATTGGGGAGAATGG - Intergenic
1075189350 10:120292114-120292136 ATCCAGGTCTATGGGTTATATGG - Intergenic
1076508838 10:130998119-130998141 ATCCATTTCTTTTGGGGATGAGG + Intergenic
1077948999 11:6933919-6933941 GTCCAGTTTTTAAGGGAATAGGG + Intronic
1078302452 11:10146139-10146161 ATAAATTTCTTTGGGCAATATGG - Intronic
1078312173 11:10255413-10255435 GTCAAGTTCTTTGGGGGAAATGG + Intronic
1079413356 11:20209993-20210015 ATTCAGTGTTTTGGGGGATATGG + Intergenic
1080401479 11:31940414-31940436 ATCCAGTTCTAGAAGGAATAAGG + Intronic
1082912597 11:58393685-58393707 ATGGAGCTCTCTGGGGAATAGGG + Intergenic
1086080588 11:82899693-82899715 ATTCAGTCTTATGGGGAATAGGG + Intronic
1090292415 11:125556709-125556731 ATGCAGTTCTCTGAGGAACAGGG - Intergenic
1090853516 11:130591770-130591792 GTAGAGTTCTTTGGGCAATATGG + Intergenic
1091297643 11:134485317-134485339 ATTGAATTCTTTGGGGAAGAAGG - Intergenic
1092519362 12:9251769-9251791 ATAAATTTCTTTGGGCAATATGG - Intergenic
1094394542 12:29991821-29991843 ATCAAGGTCTTTGGGGAGCAGGG + Intergenic
1095013737 12:36941176-36941198 TTCTAGTGCTTTGAGGAATATGG + Intergenic
1095023801 12:37103999-37104021 TTCTAGTGCTTTGAGGAATATGG + Intergenic
1095920223 12:47522129-47522151 ATACATTACTTTGGGCAATATGG + Intergenic
1097910307 12:64962302-64962324 ATACATTACTTTGGGGAGTATGG + Intergenic
1097972549 12:65650037-65650059 ACCAAGTTCTTTGAAGAATAAGG + Intergenic
1099646700 12:85366722-85366744 ATCCTGTGCTTCGGGGAAAAAGG - Intergenic
1099675050 12:85748382-85748404 ATGCATTTCTATGTGGAATATGG + Intergenic
1100932280 12:99623372-99623394 ATCCAGTACTATGTTGAATAGGG - Intronic
1101790509 12:107922490-107922512 ATCTATTTCTTTGGGCATTATGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1106409021 13:29498198-29498220 ATCCAGTTCTGTGGGGGAACAGG - Intronic
1106759099 13:32850266-32850288 ATACAGTTCTTTGGGCTGTAAGG + Intergenic
1107071106 13:36270336-36270358 ATGCATTGCTTTGGGCAATATGG - Intronic
1107309108 13:39057628-39057650 ATACATTGCTTTGGGCAATATGG + Intergenic
1109548097 13:63855540-63855562 ATCCTGTTCTGAGAGGAATAAGG - Intergenic
1110331801 13:74281471-74281493 AACCAGTTCTTAGAGAAATAGGG + Intergenic
1113397222 13:109959560-109959582 ATACATTGCTTTGGGCAATATGG + Intergenic
1116039923 14:39673745-39673767 TTCCTTTTCTTTGGGGAAAATGG - Intergenic
1116319419 14:43441194-43441216 ATACATTACTTTGGGGAGTATGG - Intergenic
1117902288 14:60547525-60547547 CTTGATTTCTTTGGGGAATAAGG + Intergenic
1117931984 14:60853120-60853142 ATGAATTTCTTTGGGCAATATGG + Intronic
1119597041 14:75944554-75944576 TCCCAATTCTTTGGGGAAAATGG - Intronic
1120977440 14:90261512-90261534 CTTCAGGTCTGTGGGGAATAGGG + Intronic
1121038849 14:90728637-90728659 AGCCTGTTCTTTGGGGAGAAAGG - Intronic
1121765732 14:96483888-96483910 ATTCAGTGATTTGGGGAATGAGG - Intronic
1122031186 14:98913881-98913903 AGCCAGTTCTTTGGGGAAGCAGG + Intergenic
1124819494 15:33030394-33030416 TTTCAGTTCTTTGGGGATTCAGG - Intronic
1125772482 15:42179118-42179140 ATCCAGTTCTTTGGGGAATAAGG - Intronic
1126765722 15:52009095-52009117 ATCCTGTCCTTTGAGGAAGAAGG - Intronic
1127250351 15:57229362-57229384 ATCCCCTAGTTTGGGGAATATGG - Intronic
1128470440 15:67947066-67947088 CTCCAGTCCTGTGGGAAATAAGG + Intergenic
1129151682 15:73692817-73692839 AACCAGTTTTATGGGGAAGATGG + Intronic
1130429518 15:83832420-83832442 AGCCAGTTCTTTGGGTGATGAGG + Intronic
1134767202 16:16770571-16770593 ATCCATTACTTTGGGCAGTATGG + Intergenic
1135052896 16:19206781-19206803 ATCCAGTCCTATGGGATATAGGG + Intronic
1138262449 16:55634810-55634832 CCCCAGTTCTTTGGGGAAAATGG - Intergenic
1140131912 16:72170227-72170249 TACCAGTTCTGTGGGGAACAAGG - Intronic
1143537536 17:7550106-7550128 ATTCAGTTCCTAGGGGAATTAGG - Exonic
1150953163 17:69824691-69824713 AGCAAGTTCATTGGAGAATAAGG - Intergenic
1151132701 17:71914623-71914645 TTCCTCCTCTTTGGGGAATATGG + Intergenic
1153948953 18:10041297-10041319 ATCCTGTTCTGGGAGGAATAAGG - Intergenic
1155855869 18:30833778-30833800 ATCCAGTTTTTGGAGGCATAGGG + Intergenic
1157102522 18:44743514-44743536 AACCAGATCCTTGGGCAATATGG - Intronic
1157203593 18:45679812-45679834 ATTCAGTTCACTGGGGAAGACGG - Intronic
1157933217 18:51845820-51845842 ATACAATTCTTTGGGGAGTTGGG - Intergenic
1161805636 19:6441612-6441634 ATCCAGTGATTTGGGGGATGGGG + Exonic
1165686228 19:37822844-37822866 AACCACTTCTTTGGGGAAAAGGG - Intergenic
1165972758 19:39646645-39646667 GTACATTTCTTTGGGCAATATGG - Intergenic
1166062670 19:40336371-40336393 ATCCAGTTCTTTAAGGAAGCCGG - Exonic
1166666547 19:44683783-44683805 ATCCAGATCTTGGGGGACTTTGG - Exonic
1168097176 19:54122554-54122576 ATCCAGTGCATTGGGGACCAAGG - Exonic
1168394371 19:56035753-56035775 AATAAGTACTTTGGGGAATACGG - Intronic
1168654255 19:58116156-58116178 ATCCAGTGCCTCGGGCAATATGG - Intronic
926081636 2:9991497-9991519 AGCCAGATCATTGGGGAAGATGG + Intronic
926495173 2:13577567-13577589 TTACAGTCCTTTGGGGAACACGG + Intergenic
926804768 2:16697284-16697306 ATAGATTGCTTTGGGGAATATGG + Intergenic
927006689 2:18857890-18857912 ATAAATTTCTTTGGGGAGTATGG + Intergenic
927445546 2:23157867-23157889 ATCCAGCCCTTTGAGGAATCTGG - Intergenic
930459151 2:51648702-51648724 ATACAATTCCTTGGGGATTAGGG - Intergenic
932916394 2:75863718-75863740 ATCCAGATCTTAGTGTAATAGGG + Intergenic
934765193 2:96876586-96876608 ATCTAGTTCCTTGGGGAGTGAGG + Intronic
935686519 2:105688642-105688664 ATACAATTCTTTGGGGCAAATGG + Intergenic
935877488 2:107526992-107527014 ATACATTTCTTTGGGCAATTTGG - Intergenic
937586620 2:123559344-123559366 ATACATTGCTTTGGGGAGTAAGG + Intergenic
937943071 2:127304017-127304039 ATGCAGTTTCTTTGGGAATAAGG + Exonic
938795649 2:134716901-134716923 ACCGGGTTCTTTGGCGAATAGGG + Intronic
940466069 2:154028591-154028613 AGCCAGTTCATTAGGGAATTGGG + Intronic
940851349 2:158690628-158690650 AGCAAGTTCTTTGGAGAACATGG + Intergenic
940917104 2:159267958-159267980 ATCAAGTGCTTTTGGGTATATGG - Intronic
941286204 2:163616078-163616100 ATCCAGTTATATAGGAAATATGG - Intronic
943037698 2:182767080-182767102 ATTCCCTTCTATGGGGAATAAGG - Intronic
945754098 2:213824810-213824832 ATAGATTTCTTTGGGTAATATGG + Intronic
1168877172 20:1179961-1179983 ACCCAGTTCTCTGGGCAAGAAGG - Intronic
1171137960 20:22714443-22714465 ATACATTTCCTTGGGGAGTATGG + Intergenic
1173135799 20:40437863-40437885 ATCCAGTGGGTTGGGGAATTGGG - Intergenic
1175089617 20:56491263-56491285 ATCCAGGTGTTTGGAGAATTTGG + Intronic
1175564640 20:59963449-59963471 ATCCTGTTCTATGGGCAATATGG - Intronic
1177320301 21:19512447-19512469 ATCCAGATATTTTGGGAACAAGG + Intergenic
1177596972 21:23257012-23257034 ATGCAGTTCTTTGGAGAATTTGG + Intergenic
1178048791 21:28726059-28726081 ATAAAGTTCTGTGGGGAAAATGG - Intergenic
1179566118 21:42250281-42250303 ACCCAGCTCTTTGGGGACTTTGG + Intronic
1180249918 21:46577708-46577730 ATACATTACTTTGGGGAGTATGG + Intergenic
1181078480 22:20397360-20397382 ATCCAGTGTTTTGGGGGGTAAGG + Intronic
1182294288 22:29304116-29304138 ATCCACTTCTCTGGGGAGGAGGG - Intergenic
1182655646 22:31887686-31887708 ACCCATTTCTTTTGGGAAGACGG - Intronic
1183477296 22:38042629-38042651 AGACAGTTCTTTGGGGAAGCTGG + Intergenic
1183972547 22:41488764-41488786 CTCCAGGCCTTTGGGGATTAAGG + Intronic
949416484 3:3820390-3820412 AGCCTTTTCTTTAGGGAATATGG + Intronic
951238916 3:20267420-20267442 ATACATTACTTTGGGCAATATGG + Intergenic
951485978 3:23210308-23210330 GGCCAGGTCTGTGGGGAATAGGG + Intronic
951561487 3:23971204-23971226 ATCCAGTTTTCTGAGGAATAAGG - Intronic
955111262 3:55952548-55952570 TTCCAGTTCCTTAGGAAATAAGG + Intronic
955559672 3:60175163-60175185 ATCCAGCTCTGTGGGGAAAGAGG - Intronic
956918791 3:73904082-73904104 ATAAATTTCTTTGGGGAGTATGG - Intergenic
957858440 3:85909879-85909901 ATTCATTTCTTTGGGGAAGAAGG + Intronic
958082427 3:88763495-88763517 ATAAATTTCTTTGGGTAATATGG + Intergenic
958497862 3:94867444-94867466 AACAAATTCTTTGGGCAATATGG + Intergenic
961601551 3:128066330-128066352 ATCCACATCTGTGTGGAATATGG - Intronic
962929180 3:140021744-140021766 ATCAATTTCTTTGGGGTTTAAGG + Intronic
963458138 3:145573338-145573360 CCCCACTTCTTTGGGGAAAATGG + Intergenic
966141059 3:176756471-176756493 AGCCAGTTCTTCTGGGCATATGG - Intergenic
967025495 3:185560800-185560822 ATTCCCTTCTATGGGGAATAAGG + Intergenic
967696144 3:192533329-192533351 ATTCAGGTTTTTGGGGAACAAGG + Intronic
970411752 4:15815343-15815365 ATCAATTACTTTGGGCAATATGG + Intronic
971294897 4:25379324-25379346 ATCCAGATCTTTAAGGAATGAGG + Intronic
972024292 4:34357912-34357934 CCCCAATTCTTTGGGGAAAATGG + Intergenic
972698963 4:41475557-41475579 AACCAGTTCTCATGGGAATAGGG - Intronic
972987064 4:44777709-44777731 CCCCAATTCTTTGGGGAAAATGG - Intergenic
974533696 4:63146675-63146697 ATCAATTACTTTGGGCAATATGG - Intergenic
975492248 4:75002088-75002110 CTCCAGCTCTCTGGGGAACAAGG + Intronic
975906272 4:79216140-79216162 ATCTAGTCCTTTGGGGAGCAAGG + Intergenic
976012313 4:80505298-80505320 ATCCAGTTCTTTTCTGAAAAAGG + Intronic
976786816 4:88830829-88830851 AGCCAGTTCGTTGGTGAAGAAGG - Intronic
977789668 4:101084699-101084721 ATTCAGTTCTTTGGCAAAAAGGG + Intronic
977845870 4:101766138-101766160 GTACATTTCTTTGGGCAATATGG + Intronic
978685949 4:111443757-111443779 ATAGATTTCTTTGGGCAATATGG + Intergenic
978824785 4:113008865-113008887 AGCCTGTTCATTGGGGAAAAGGG + Intronic
980602106 4:135039060-135039082 ATCCAGTGGTATGGGGAATGTGG + Intergenic
980660236 4:135848464-135848486 ATAAATTTCTTTGGGAAATAAGG - Intergenic
981101014 4:140829213-140829235 ATTCAGTTGTTTGGGGACTCAGG + Intergenic
981525733 4:145705487-145705509 CCCCAATTCTTTGGGGAAAATGG + Intronic
982206470 4:153000779-153000801 TTCCAGTTCTCTGGGGATGAGGG + Intergenic
982266647 4:153544190-153544212 ACCCAGTTCGCTGAGGAATATGG + Intronic
982623791 4:157738648-157738670 ATCCTGTTCTTTGGTCAATTAGG - Intergenic
982980419 4:162127160-162127182 ATTTAGCTCTTTGGGGAAAATGG - Intronic
983658418 4:170106997-170107019 CTCCAATTCTTTGGGGAAAATGG - Intergenic
983748181 4:171228231-171228253 ATACATTACTTTGGGCAATATGG + Intergenic
985242380 4:187944221-187944243 ATCCAGTTCTTGAAGGATTAAGG - Intergenic
986786158 5:11115810-11115832 ATTCAGATCTCTGGGGAGTAAGG + Intronic
988505461 5:31818427-31818449 AACCAGTTCTCTGGGGAGGATGG - Intronic
988863077 5:35304921-35304943 TTCCATTTCTTTTGGAAATAAGG - Intergenic
988881609 5:35509385-35509407 ATACATTGCTTTGGGCAATAGGG + Intergenic
989032223 5:37131185-37131207 ATGCAGTTATTTGGGGGATGGGG + Intronic
989941217 5:50152151-50152173 TTGCAGTGCTTTGAGGAATATGG - Intergenic
990259677 5:54008393-54008415 ATCCAGTGCTTTGGGTACAAAGG - Intronic
992583285 5:78204536-78204558 ATGGAATGCTTTGGGGAATAAGG - Intronic
992871130 5:81006709-81006731 ATCCTGTGCTTTGGGGCAGACGG - Intronic
993208449 5:84917633-84917655 ATTAATTGCTTTGGGGAATATGG - Intergenic
994550877 5:101233377-101233399 ATACATTTCTTTGGGTAGTATGG + Intergenic
995162346 5:108996837-108996859 ATACATTACTTTGGGCAATATGG + Intronic
996895799 5:128481055-128481077 AAACAGATCTTTGGGAAATAGGG - Intronic
997550580 5:134748727-134748749 AAAAAGTTCTTTGGGGTATAGGG - Intronic
997608962 5:135197916-135197938 TTCCAGTACTATGTGGAATAGGG + Intronic
997828976 5:137132732-137132754 ATCCAGTGCTTTGGGGTCAATGG + Intronic
998363663 5:141613885-141613907 AGCCAGGCCTTTGGGGAATTAGG - Intronic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1001699539 5:173697054-173697076 AGCCAGGTCTTTGGAGAAAAGGG + Intergenic
1002891555 6:1337072-1337094 ATCCAGTTCATTGGAAAACATGG - Intergenic
1004215293 6:13697798-13697820 ATGCAGTCCTTTTGGGGATATGG - Intronic
1005945562 6:30592830-30592852 ATCCAGTTCCAGAGGGAATAGGG + Intronic
1010468799 6:76200901-76200923 ATACATTACTTTGGGCAATATGG - Intergenic
1010798552 6:80146699-80146721 ATCAAGTACTTCTGGGAATAGGG + Intronic
1011079115 6:83470289-83470311 TTTCAGTTCTTTTGGGTATATGG + Intergenic
1011143392 6:84185811-84185833 CTCCAGTTCTTTGTGGAATAAGG - Intronic
1011748520 6:90432359-90432381 ATTCCGTTCTTTGGGCACTAGGG - Intergenic
1011964361 6:93135611-93135633 ATGCAGTGCCTTGGGGAACATGG + Intergenic
1014242684 6:119035196-119035218 ATTCAGTTCTTTGGGGAACTTGG - Intronic
1014327996 6:120023750-120023772 ATACATTTCTTTGGGCAGTATGG + Intergenic
1014504815 6:122242417-122242439 ATCAAGCTGTTTGGGGAATGGGG - Intergenic
1015128366 6:129781108-129781130 ATGCATGTCTTTGGGGAACAGGG - Intergenic
1015610081 6:135007768-135007790 TTCCAGTTGTTTGGGGAAGATGG - Intronic
1017922614 6:158885312-158885334 ATCAAGTTGTTTGGGCAAAAAGG + Intronic
1018108929 6:160516458-160516480 ATAAATTACTTTGGGGAATATGG - Intergenic
1019406597 7:887291-887313 ATCCACTTCTGTGGGGAATGTGG + Intronic
1020443912 7:8248383-8248405 CTTCAGTTCTTTGGGAAGTAGGG + Intronic
1021512679 7:21451462-21451484 CCCCAGTTCTTTGGGGAAAATGG + Intronic
1022905070 7:34847873-34847895 ATCCATTTCTTTTGAGAATTTGG + Intronic
1024719731 7:52121800-52121822 ATGCATTTCTTTTGGGGATATGG - Intergenic
1025596878 7:62940441-62940463 ATTCAGGTCTTTGGTGAAAAAGG - Intergenic
1025742114 7:64206278-64206300 ATCCTGTTCTTGGGATAATAAGG - Intronic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1028460355 7:91085286-91085308 ATTCAGTTCCTTGGGGGGTATGG + Intronic
1031691533 7:124794065-124794087 ATCCAGTGCTTTGAGGAGGATGG - Intergenic
1032271945 7:130417066-130417088 ATCCTGTTCTTAGGGGATTCTGG + Intronic
1032498465 7:132380741-132380763 AGCAAGTTCTTTGGGTGATAGGG - Intronic
1036077170 8:5514758-5514780 CTTCGGTTCCTTGGGGAATATGG - Intergenic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1038044698 8:23756185-23756207 ATTCATTTCTTTGGGGTATAGGG + Intergenic
1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG + Intronic
1040492525 8:47937862-47937884 GTCCAGTGCTTTGGGGACTGAGG + Intronic
1046085323 8:109427218-109427240 CTCCAGTTCTTTTTGGAATAAGG - Intronic
1050404892 9:5297585-5297607 ATAAATTTCTTTGGGCAATATGG - Intergenic
1055234477 9:74103921-74103943 ATCAATTACTTTGGGCAATATGG - Intergenic
1058335549 9:103823846-103823868 ATGCAGTTATTTGGGAAAAATGG + Intergenic
1058583317 9:106481854-106481876 AACCAGTTCTTTGGGAAGAAAGG + Intergenic
1059003350 9:110374296-110374318 ATCATGTTCTTTGTGGAATATGG - Intronic
1059298124 9:113290645-113290667 ATCCAGTTCTCTGTGGAAGCAGG - Intronic
1060503858 9:124183108-124183130 CTCCAGGCCCTTGGGGAATAAGG - Intergenic
1185753953 X:2637880-2637902 TTCCAGTTCTTGGGGGTAAAAGG + Intergenic
1186369661 X:8933739-8933761 ATCAATTACTTTGGGCAATATGG + Intergenic
1186431334 X:9507507-9507529 ATAAAGTACTTTGGGCAATATGG - Intronic
1187967788 X:24630182-24630204 CTCAAGTTCTTTGGGGAAGGAGG - Intronic
1188967536 X:36573474-36573496 GTCCAGTGATTTGGGGAATCTGG - Intergenic
1191121745 X:56913189-56913211 ATAAAGTTCTTTGGGTGATATGG + Intergenic
1192507469 X:71697735-71697757 ATTCCGTTCTATGGGGAATAAGG + Intergenic
1192519227 X:71783817-71783839 ATTCCGTTCTATGGGGAATAAGG - Intergenic
1192954492 X:76054206-76054228 ATACATTGCTTTGGGCAATATGG + Intergenic
1194215386 X:91124381-91124403 CACCAATTCTTTGGGGAAAATGG - Intergenic
1194850676 X:98864883-98864905 CCCCAATTCTTTGGGGAAAATGG - Intergenic
1195145025 X:102004947-102004969 ATACATTGCTTTGGGCAATATGG - Intergenic
1197491577 X:127123096-127123118 ATAGATTTCTTTGGGCAATATGG - Intergenic
1199833543 X:151566334-151566356 ATCCTCCTCTTTGGGGAAGATGG - Intronic