ID: 1125787044

View in Genome Browser
Species Human (GRCh38)
Location 15:42328404-42328426
Sequence CCTGCTTTAGATGGTTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125787039_1125787044 -4 Left 1125787039 15:42328385-42328407 CCAAAAATGTTTGCCAATCCCTG 0: 1
1: 2
2: 14
3: 39
4: 251
Right 1125787044 15:42328404-42328426 CCTGCTTTAGATGGTTCTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 117
1125787038_1125787044 2 Left 1125787038 15:42328379-42328401 CCTTTACCAAAAATGTTTGCCAA 0: 2
1: 9
2: 59
3: 318
4: 908
Right 1125787044 15:42328404-42328426 CCTGCTTTAGATGGTTCTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125787044 Original CRISPR CCTGCTTTAGATGGTTCTAA AGG Intronic
901932985 1:12608795-12608817 CCTGTTCTAGATGGTTCTGGAGG - Intronic
902075516 1:13781549-13781571 TCTTCTTTAGAAGTTTCTAAAGG - Exonic
904774643 1:32899278-32899300 CCTTCTTTAGCTGCTTCTGATGG + Intronic
904876234 1:33656633-33656655 CCTGCTGGAGATGGGTGTAAGGG - Intronic
905534170 1:38706581-38706603 ACTGCTTGATATTGTTCTAAAGG - Intergenic
906068645 1:43001292-43001314 CCTGCTACAGGTGGTCCTAAAGG - Intergenic
909923522 1:81411316-81411338 CCTCCTTTAAATTGTTATAATGG - Intronic
910976320 1:92909941-92909963 CCTGCTTTAGACTGTACAAAGGG - Intronic
915243360 1:154539856-154539878 ACTTCTTTAGATGGTTCTTAGGG + Intronic
915883454 1:159698592-159698614 CCTGATTTTGATGGTTGTATTGG + Intergenic
917451384 1:175150548-175150570 TTTGCTTTAGTTTGTTCTAAAGG - Intergenic
918044081 1:180930835-180930857 CTTGCTGCAGATGCTTCTAAAGG + Intronic
921486507 1:215721467-215721489 CCTGCCTTAGATGTTACTGATGG + Intronic
924453510 1:244199690-244199712 CCTGTGTTAGATGTTTCTGATGG - Intergenic
1064159003 10:12927792-12927814 CCTGCTCCAGATGATTCTAATGG - Intronic
1070635280 10:78120771-78120793 CCTTCTGTAGATATTTCTAAAGG - Intergenic
1070669080 10:78365471-78365493 CCTCCTTTTCCTGGTTCTAAAGG - Intergenic
1071037843 10:81268559-81268581 CCTGCTTTATATGGTTATTAGGG + Intergenic
1071445853 10:85746327-85746349 CCTGCTTCTGATGGCTATAATGG - Intronic
1071800407 10:89053925-89053947 CCTGCTAAAGATGGTCCTTAGGG - Intergenic
1074612646 10:115036863-115036885 CCTGCTTTAGATGGTCATTCAGG + Intergenic
1075448932 10:122533978-122534000 GTTGCTTTAAATGTTTCTAAGGG - Intergenic
1079316744 11:19413894-19413916 CCTGCTTTATAAGATTCTGAAGG + Intronic
1079365919 11:19809718-19809740 CTTGTTTTTGATGCTTCTAATGG + Intronic
1079481309 11:20883246-20883268 CCTGCTTTAGCTGGTGATAGTGG + Intronic
1080707890 11:34715213-34715235 CCTGCCTTGGATGGCTGTAAAGG - Intergenic
1082134762 11:48534406-48534428 CGTGCTTTAGATTGTTGTTATGG + Intergenic
1085582332 11:77664741-77664763 CCTGTTTTAGATGGTTTAAAAGG + Exonic
1086427542 11:86701303-86701325 CCTGCTGTAGAACTTTCTAAAGG - Intergenic
1090097979 11:123762664-123762686 TCTGTTTTACATTGTTCTAAAGG + Intergenic
1091781480 12:3216869-3216891 CCTGCTTTGGAGGGCTCTGAGGG + Intronic
1095889539 12:47222881-47222903 CCTGGTTTGGATGGTTACAACGG - Intronic
1098628039 12:72697396-72697418 CCTGTATTAGCTGGTTCTAAGGG - Intergenic
1098655333 12:73021654-73021676 CCTGCTTCAGAAGGGACTAATGG - Intergenic
1102543685 12:113639743-113639765 CCTCCTATAGATGGGTGTAAAGG - Intergenic
1109943835 13:69406370-69406392 TTTGCTTTAGCTGGTTATAAAGG - Intergenic
1110831322 13:80034871-80034893 CCTGCTATAGATGTTGCTCAAGG - Intergenic
1114361200 14:21975208-21975230 CCTGCTTTAGCTGGGACTACAGG + Intergenic
1114706250 14:24729481-24729503 CCTGCTTTAGCTGTGTCTCAGGG - Intergenic
1114815248 14:25949730-25949752 CATATTTTAGCTGGTTCTAAAGG - Intergenic
1115406081 14:33018359-33018381 CCCACTTTAAATGGTTCTGAAGG - Intronic
1123874256 15:24607711-24607733 CCCGCTGGAGATGGCTCTAATGG + Intergenic
1125787044 15:42328404-42328426 CCTGCTTTAGATGGTTCTAAAGG + Intronic
1128809974 15:70563655-70563677 GCTGCTTTACATGGCTCTCATGG + Intergenic
1133283727 16:4681068-4681090 CCTGCTCCAGGTGGTTCTAACGG - Intronic
1137532150 16:49284658-49284680 ACTGCTTTTGAGGTTTCTAATGG - Intergenic
1138134816 16:54512390-54512412 CCTGCTGAAGAGGGTTCTGAGGG - Intergenic
1144626884 17:16848433-16848455 CCTGCTTTAATTGGGTCTATTGG - Intergenic
1145152685 17:20520108-20520130 CCTGCTTTAATTGGGTCTATTGG - Intergenic
1148529685 17:48377862-48377884 CCTGCTTTTGAATGTTTTAATGG - Intronic
1153316658 18:3729139-3729161 GCTGCTCTGGATGGTCCTAACGG + Exonic
1160037595 18:75316167-75316189 CCTATTTTAGGTGATTCTAAGGG - Intergenic
1164073036 19:21786737-21786759 GGTGCTTTAGATAGTTCCAAGGG + Intergenic
1164721705 19:30437370-30437392 GCTGCCTTTGATGGTGCTAATGG - Intronic
1166186806 19:41145070-41145092 CCTGCTTTAGCGGGTTGTTAAGG - Intergenic
926623752 2:15071687-15071709 CCTGCTTTATATGGTAGCAAAGG + Intergenic
927449991 2:23200407-23200429 CCTGCTTTACCTTGTTCTGAAGG + Intergenic
941732667 2:168935496-168935518 CCTGGATTAGATGGTGCAAATGG + Intronic
943247883 2:185478510-185478532 TCTGCCTTAGATACTTCTAAAGG + Intergenic
945085607 2:206129093-206129115 CTTGATTCAGATGTTTCTAAAGG - Intronic
947913540 2:233817995-233818017 CCAGCTTTAGGTGGATCTGAGGG - Exonic
948225688 2:236307632-236307654 CCTGCCTTAGATGATCCTAGAGG - Intergenic
948975026 2:241458762-241458784 GATTCTTTAGATGGTTCTATAGG + Intronic
949078231 2:242074982-242075004 CCTGCTGTTGAAGGTTCTCAGGG + Intergenic
1170425990 20:16236154-16236176 CCTGCTTTAGAAGGTTTTATGGG - Intergenic
1170741585 20:19063281-19063303 CATTCTCTAGATGGTTCTTAGGG + Intergenic
1172772676 20:37390859-37390881 CCTGATTTAGAGGGGTCTGAGGG - Intronic
1178898004 21:36576583-36576605 CCTGCTTTAGCTGGGCCTCAGGG + Intergenic
1181781166 22:25194452-25194474 ACTGCTTGAGATGGTACCAAGGG - Exonic
1183848506 22:40562996-40563018 CCTCCTCTTGATGGTTCTACAGG + Intronic
949776525 3:7638806-7638828 CCTGCATTAGTTGTATCTAAAGG + Intronic
955605915 3:60703262-60703284 CCTGCCTTTGAAGGCTCTAAGGG - Intronic
955618890 3:60839752-60839774 CCAACTCTAGATGCTTCTAAGGG - Intronic
956083944 3:65589807-65589829 CTTGCTTTAGATGGTTGCCAGGG + Intronic
957808512 3:85185393-85185415 CCTGCTTTAGATAATACAAAAGG - Intronic
961918531 3:130402107-130402129 CCTGCTTTAGAAAGTTTGAAAGG + Intronic
964367520 3:155965928-155965950 CATGCTTTAGCTGTTTCTTATGG + Intergenic
964370509 3:155995116-155995138 CCTGTGTTAGATTGTTCTCAGGG + Intergenic
965296853 3:166957489-166957511 CCAGGTTTAGATGGTTATATAGG + Intergenic
968684094 4:1944769-1944791 CCTGCTCTAGATGGATCTTTGGG + Intronic
969402733 4:6967647-6967669 TCGGCTTTAGATGTTTATAATGG + Intronic
970519239 4:16865476-16865498 CCTGCTGGAGATGGCACTAAGGG + Intronic
971782757 4:31057909-31057931 CATGCTTTCTATGATTCTAAAGG - Intronic
973652035 4:53006074-53006096 CATGCTTTTGATGGTCCTGATGG - Intronic
976100005 4:81551217-81551239 CCTGCCTTTGCTGGGTCTAATGG + Intronic
982130809 4:152227197-152227219 CCTGCTTTTGATGCTGCGAAAGG - Intergenic
982965936 4:161907879-161907901 GCTGCTATATATGGTTCTCATGG + Intronic
983194976 4:164797031-164797053 CCTGCTTTAGGTTGTTCTACTGG + Intergenic
984942585 4:184946730-184946752 CCTGCTTTAAAAGGATTTAAGGG - Intergenic
985095687 4:186410701-186410723 CCTGATTTTGATGGTTGTATTGG + Intergenic
988283113 5:29175297-29175319 GCTGCATTATATGGTTCTGATGG + Intergenic
991034308 5:62112765-62112787 CCTGCTTAAAATGCTTTTAAAGG + Intergenic
991932240 5:71765390-71765412 CATGCCTTGGATGGTTCCAAAGG + Intergenic
993019125 5:82569950-82569972 CCTGATTTAGATGTTTATGAAGG - Intergenic
1000539672 5:162525064-162525086 CCAGTTTTAGATGGTTCAGAGGG + Intergenic
1002963780 6:1942385-1942407 CCTACTTCACATGGTTCTAATGG + Intronic
1003980610 6:11386620-11386642 GCTGCTTTAGATGGTTGAACAGG + Intergenic
1004691532 6:17996391-17996413 TGTGCTTTAGCTGGTTCCAAAGG - Intergenic
1005041012 6:21600566-21600588 CCTGCTTTTGAGGGTACTAGGGG + Intergenic
1006463406 6:34177090-34177112 TGTGCTTGAGATGGTGCTAAGGG - Intergenic
1009276987 6:61695406-61695428 CCTTCTCTAGAGGATTCTAATGG + Intronic
1009873204 6:69473707-69473729 CCTGGTTTAGATGGTTGCAGGGG - Intergenic
1010563248 6:77376862-77376884 CCTGCTTTAGAAGATCTTAAAGG + Intergenic
1010939411 6:81897962-81897984 CCTGCCTTACATAGTTCAAAGGG + Intergenic
1014523615 6:122474849-122474871 CCTGCTTTACATTTTTCTCAGGG - Intronic
1014671759 6:124313368-124313390 CCTGCCTGAGATGCTTTTAAGGG - Intronic
1018510929 6:164524072-164524094 CCTTGTTTAGATTGCTCTAAGGG + Intergenic
1021252973 7:18354796-18354818 CCTGTTTTAGATCCTTCTGAAGG - Intronic
1022725857 7:32980970-32980992 GCTGTTTTAGATGGTTCTGCAGG + Intronic
1023108588 7:36787785-36787807 CCTGCTTTAGAAGGTGTTATGGG - Intergenic
1025047741 7:55706679-55706701 GCTGTTTTAGATGGTTCTGCAGG - Intergenic
1026268986 7:68820124-68820146 CCTGCTTTAGATTTTGCTAAAGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1033174885 7:139114649-139114671 CCTCCTTTAGCTGGTTATATGGG + Intergenic
1037718307 8:21418723-21418745 CCAGGTTTAGATTCTTCTAAAGG + Intergenic
1039920821 8:41893251-41893273 CCTGCTTTTGAAGGTTGGAATGG - Intronic
1041253226 8:55954943-55954965 CATTCTTTTAATGGTTCTAATGG + Intronic
1043564312 8:81531474-81531496 TCTGCTTTAGATGATACTCAAGG - Intergenic
1043999258 8:86858727-86858749 CCTGCTTTATAGGGTTGTGAGGG + Intergenic
1048333188 8:133485055-133485077 CCTGCATTCGAGGGTTCTCAGGG + Intronic
1048776749 8:137955014-137955036 CCTTCTTTAGATGGTTTAGATGG - Intergenic
1051848083 9:21475662-21475684 ACTGCTCAAGATGGTGCTAATGG + Intergenic
1057955763 9:99406545-99406567 CCTACTTTAGAAGGCTGTAAAGG + Intergenic
1058119066 9:101118630-101118652 CCTACTTTAGATCATGCTAAGGG + Intronic
1059553632 9:115255622-115255644 CCTGATTTTGATGGTTGTACTGG - Intronic
1186330775 X:8530599-8530621 GCTGCTTTAGATTTTTTTAAGGG + Exonic
1187007485 X:15246883-15246905 ACTGCTTTAGATGCTTATCAAGG + Intronic
1201940931 Y:19459064-19459086 CCTCCATTATCTGGTTCTAATGG + Intergenic