ID: 1125790985

View in Genome Browser
Species Human (GRCh38)
Location 15:42365534-42365556
Sequence TCTCACTTGCTGATGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125790976_1125790985 10 Left 1125790976 15:42365501-42365523 CCACCTTCCCACTTAACTCCAGA 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 172
1125790979_1125790985 2 Left 1125790979 15:42365509-42365531 CCACTTAACTCCAGATCCAGTGC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 172
1125790978_1125790985 3 Left 1125790978 15:42365508-42365530 CCCACTTAACTCCAGATCCAGTG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 172
1125790977_1125790985 7 Left 1125790977 15:42365504-42365526 CCTTCCCACTTAACTCCAGATCC 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 172
1125790980_1125790985 -8 Left 1125790980 15:42365519-42365541 CCAGATCCAGTGCCTTCTCACTT 0: 1
1: 0
2: 0
3: 22
4: 323
Right 1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125790985 Original CRISPR TCTCACTTGCTGATGGTGGC TGG Intronic
902570136 1:17341993-17342015 TCTCACTACCTGATGGTCCCCGG + Exonic
903077247 1:20780818-20780840 TCTAAGTTCCTGATGGTGGCAGG - Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
905837161 1:41135732-41135754 ACTCACTTGCTGTATGTGGCTGG + Intronic
908753589 1:67447402-67447424 TCTCACTTTCTGAGGGTACCAGG - Intergenic
910000138 1:82331420-82331442 TTTAACTTACTGATAGTGGCAGG - Intergenic
911050488 1:93666847-93666869 TCTCACATGTTGATGGAGTCTGG - Intronic
911769845 1:101726389-101726411 TCCCACTCCCTGTTGGTGGCTGG + Intergenic
911882008 1:103251747-103251769 TCCCAGCTTCTGATGGTGGCTGG + Intergenic
914741776 1:150471726-150471748 TCTTACTCGGTGATGGTGACCGG - Exonic
915342713 1:155185165-155185187 GCTCTCTGGCTGCTGGTGGCAGG + Intronic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
918444390 1:184602258-184602280 TTTCACATGCTGGTGGTGGGAGG + Intronic
920618770 1:207523628-207523650 TCTCCATTGGTGATGGTGGGGGG - Exonic
920836584 1:209516533-209516555 TCTCACGTGCTAATCATGGCTGG - Intergenic
921245544 1:213235524-213235546 TCTCACTTCCTGAAGGTCTCTGG - Intronic
921418408 1:214917497-214917519 TCTGCCTTCCTGATGGAGGCTGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923012930 1:230103451-230103473 TCACAGTTGCAGATGTTGGCTGG - Intronic
923291474 1:232550331-232550353 TCTGACTTGCGGTGGGTGGCTGG - Intronic
923811308 1:237320213-237320235 TCTCACTTGGTCATGGGGGGAGG + Intronic
924420554 1:243905471-243905493 TCTTCCTTGCTGCTGGTGTCTGG + Intergenic
924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG + Intronic
1063411673 10:5841026-5841048 TCTCACTCGCTGCAGGTGACCGG + Intronic
1063899332 10:10716132-10716154 TCTCAATTGCTGACGGTATCAGG - Intergenic
1064364991 10:14699582-14699604 TATCCCTTGCTGATGTGGGCAGG - Intronic
1068131914 10:52905724-52905746 TCTCACTTGATCAGGGTGGTTGG + Intergenic
1070283179 10:75065018-75065040 TCTCACTTGCTCCTGGGGCCTGG + Intergenic
1072943850 10:99791711-99791733 TCTCACTGGCTGTTGGCGGAAGG + Intronic
1074709184 10:116163007-116163029 TGTCACATGCTGCTGCTGGCAGG + Intronic
1076128389 10:127993917-127993939 TCTCAGTTGCTGGTCGGGGCAGG + Intronic
1083221569 11:61256355-61256377 TCTAACCTGCGGCTGGTGGCAGG - Intergenic
1083296628 11:61718708-61718730 TGTCACTTCCTGAGGGTGGGGGG + Intronic
1083958097 11:65997966-65997988 TATCACTTCCAGAAGGTGGCTGG - Exonic
1084300938 11:68251979-68252001 TCTCACTGGCTTTTGGAGGCTGG - Intergenic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1088085649 11:105976232-105976254 TGTACCTTGCTGATGATGGCTGG - Intronic
1092091511 12:5807652-5807674 TCTCACCTGATGGTGGTGGAAGG - Intronic
1092851804 12:12635762-12635784 TCTCGCTTGCTGAAGGTGGTTGG + Exonic
1101000952 12:100356901-100356923 TCTCACTTGGTGAGAGCGGCAGG + Intergenic
1101448049 12:104752170-104752192 TCCCAGCTGCTGGTGGTGGCCGG + Intronic
1101491168 12:105210984-105211006 TGTCATTTGCTGAGGGTAGCAGG - Intronic
1103618776 12:122172997-122173019 TCTCACGTGCTCAGGGTGGTGGG + Intronic
1103625063 12:122212429-122212451 TCTCACTTTTTGATGGTAGTTGG + Intronic
1106080410 13:26495951-26495973 TCCCACCTGCAGATGCTGGCAGG + Intergenic
1107173407 13:37370843-37370865 GCTCACATGATGATGGGGGCTGG - Intergenic
1107368460 13:39713127-39713149 ACTCACTTACTGATGCTGACTGG + Intronic
1112665303 13:101564984-101565006 TCTCAGTTGCTGGTGGTTGCAGG - Intronic
1112988299 13:105479521-105479543 TCCGACTTCCTGATGGTGGCCGG + Intronic
1118715743 14:68558527-68558549 TCTCAGCTTCTGGTGGTGGCCGG + Intronic
1118888040 14:69882672-69882694 TCTCCCTGGCTGATGGTGTCTGG + Intronic
1120844370 14:89112996-89113018 TCTCACTTGCATATGGTGAGAGG - Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1126342358 15:47655019-47655041 TCTAACTGTCTCATGGTGGCAGG + Intronic
1127273500 15:57422289-57422311 TCTGACTTCCTGAGGGTGGCAGG - Intronic
1128773503 15:70301512-70301534 GCTCATTTGCTGACTGTGGCAGG - Intergenic
1129409367 15:75340371-75340393 TCTCAATTGCTGATTGAGGGAGG + Intronic
1132048124 15:98582730-98582752 TCCCACTTGCTCAGGGTGCCAGG - Intergenic
1133391369 16:5412954-5412976 TCTCACTCGCTGAAGGACGCAGG + Intergenic
1134811241 16:17168720-17168742 CCTCAGTTGCTCATGGTGGCTGG - Intronic
1135289777 16:21225318-21225340 TCTCACGTGCTGAGGGAGGGAGG + Intergenic
1135324506 16:21517842-21517864 TCTGACTTCCTGTTGGTGCCAGG - Intergenic
1135683618 16:24479880-24479902 TCTCTCTTGGTAATGGTGGAGGG + Intergenic
1136335989 16:29611107-29611129 TCTGACTTCCTGTTGGTGCCAGG - Intergenic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1138702865 16:58882622-58882644 TCTCTCTTTCTGATGTTGGGGGG + Intergenic
1139893482 16:70269638-70269660 TGGCACTGGCTGATGGTGGCCGG - Exonic
1140835342 16:78788785-78788807 TCTGACTTGCTATTGGTGTCTGG + Intronic
1142036707 16:87866896-87866918 TCTGACTTCCTGCTGGTGCCAGG - Intronic
1145007983 17:19348241-19348263 GCTCCCTTCCTGATGGAGGCGGG + Intronic
1150315139 17:64162920-64162942 TCTCCCTTGCTGCTGTTGCCAGG + Intronic
1152489358 17:80619215-80619237 TCTCAGTTGTTGATGTTGGGAGG + Intronic
1152555377 17:81050305-81050327 CCTCTCTTGCAGATGGAGGCAGG + Intronic
1156295200 18:35783195-35783217 TTGCACTTGCTGAAGATGGCAGG + Intergenic
1157669644 18:49517526-49517548 GCTCACGTGATGATGGAGGCTGG + Intergenic
1158476678 18:57786271-57786293 TCTCACCTGCTCAAGGTGACAGG + Intronic
1159560518 18:69987816-69987838 TCTCACTTGTTCATGGTGTATGG - Intergenic
1160199242 18:76782501-76782523 TCTTCCATGCTGATGATGGCAGG - Intergenic
1161232593 19:3182091-3182113 TCCCAGTTCCTGCTGGTGGCCGG + Intergenic
1162243211 19:9375185-9375207 TCTCACTTGATCATGGTGTATGG + Intronic
1164840823 19:31390909-31390931 TCACAGATGCTGAGGGTGGCAGG + Intergenic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1165282110 19:34806450-34806472 TTTCACTTTCTGATGGTGCTTGG - Intergenic
1166783574 19:45354632-45354654 TCTCACACTCTGATGGTGACAGG - Intronic
925781518 2:7386416-7386438 TCTCACATGCTGCTAGTGTCTGG - Intergenic
926349163 2:11979895-11979917 ACTCAGTTGCTGAAGGTGACAGG - Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
929422874 2:41812427-41812449 TCTTACTGGCTGTTGGTGGGAGG - Intergenic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
933943610 2:87265769-87265791 TTTCACATGCTCTTGGTGGCTGG + Intergenic
936336611 2:111595808-111595830 TTTCACATGCTCTTGGTGGCTGG - Intergenic
940614978 2:156038571-156038593 TCTCAGTTGTTGCTGGTGGCTGG - Intergenic
940865891 2:158817589-158817611 TCTCACTTCCTTTGGGTGGCTGG - Intronic
941048339 2:160702131-160702153 TATCAATTACAGATGGTGGCAGG - Intergenic
949032775 2:241804849-241804871 TCTCACTTGCCAAAGGAGGCTGG + Intergenic
1170117216 20:12873225-12873247 CCTCATTTGCTGATGGTAGCAGG - Intergenic
1170468609 20:16645912-16645934 GCTCACTTGATTATGGAGGCTGG + Intergenic
1172419875 20:34807190-34807212 TCTCACTGGCTGATGGCTGGAGG - Intronic
1173062834 20:39678770-39678792 TTTCATTTGCTGAGGTTGGCTGG + Intergenic
1175969542 20:62677502-62677524 GCTCACTTCCTTAGGGTGGCAGG + Intronic
1176970301 21:15257394-15257416 TCTCATTTGCTGATGGTTGAGGG + Intergenic
1181522539 22:23457844-23457866 GCTGTCTTGCTGATGCTGGCAGG + Intergenic
1184263330 22:43332415-43332437 GCTCCCTTGCTGCTGCTGGCTGG - Intronic
1184368863 22:44069869-44069891 TCTAAGTAGCTGATCGTGGCCGG + Intronic
949097796 3:106661-106683 ACTCACATGCTGCTGGTTGCTGG - Intergenic
949242177 3:1886371-1886393 TCTCTCTTGCTCAAGGAGGCTGG + Intergenic
949832481 3:8230343-8230365 TCTCACTTGCAGGTGGTATCAGG + Intergenic
950502496 3:13373224-13373246 TCTCACTTCACAATGGTGGCAGG - Intronic
954322184 3:49839797-49839819 TCTCACTGGCCACTGGTGGCAGG + Exonic
956647758 3:71473620-71473642 TTTCATTTGCGGGTGGTGGCGGG - Intronic
956807756 3:72833862-72833884 TCTCACTTGTGGTTGGTAGCAGG - Intronic
957040996 3:75335504-75335526 CCTCACTGGCTGTTGGTGGGAGG - Intergenic
960974552 3:123161697-123161719 TCTCACTTGCTGGTCGGGGCTGG + Intronic
961045801 3:123707159-123707181 CCTCACTGGCTGTTGGTGGGAGG - Intronic
962315506 3:134357100-134357122 TCTCACTTGCTGTGGGTGAGGGG - Exonic
963851055 3:150210870-150210892 TCCCACTTGCTGCAGGTGGGGGG - Intergenic
964022274 3:152027215-152027237 TCCCACTTGCTCATGGTGAATGG - Intergenic
964344495 3:155742835-155742857 TTTCATTTGCTGATGGTGGGAGG + Intronic
965582058 3:170279055-170279077 TCTCACTTTGTGATGCAGGCTGG + Intronic
965622835 3:170657934-170657956 TCTCAGTTCCTGGTGGTTGCAGG + Intronic
966572461 3:181460796-181460818 TCAGAATTGCTGGTGGTGGCTGG + Intergenic
968328963 3:197847433-197847455 TGTGACTTGCTGATAGTGACAGG - Exonic
968947000 4:3670414-3670436 TCTCACAGGCTGATGGTGCCTGG - Intergenic
969093511 4:4715035-4715057 TCCCAGTTTCTGATGGCGGCTGG + Intergenic
969476351 4:7424587-7424609 CCTCACCTCCTCATGGTGGCAGG + Intronic
969586333 4:8096240-8096262 TCCTAGTTGTTGATGGTGGCTGG + Intronic
975746515 4:77480627-77480649 GCTCACATGGTTATGGTGGCTGG - Intergenic
977172380 4:93779431-93779453 TCTCATTTCCTCATGGTGGCCGG + Intergenic
977346145 4:95818892-95818914 TCTCATTTGCTGCTGGTTTCAGG + Intergenic
983207423 4:164925734-164925756 TCTCACTTGCTCACCGAGGCTGG + Intergenic
984914309 4:184707370-184707392 TCTCAGTTGCTGCAGGGGGCAGG - Intronic
986700442 5:10402571-10402593 TCTCATTTGTGGTTGGTGGCTGG + Exonic
987934263 5:24443557-24443579 GCTCACATGATCATGGTGGCTGG + Intergenic
990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG + Intronic
991949732 5:71935840-71935862 TCTCACCTTCTGTTGGTGGGTGG + Intergenic
993800561 5:92329299-92329321 TCTCAGTTGCAAATGGAGGCAGG + Intergenic
995145742 5:108785683-108785705 TCTCTCTTGCTGGTGGTGTCTGG + Intronic
997305589 5:132833655-132833677 TCTCCCTTAGTGATGGTGGTTGG + Intergenic
997934098 5:138095788-138095810 TCTCACGTGCTGATAGGGGCAGG - Intergenic
997955127 5:138273479-138273501 CCTGACTTACTGATGTTGGCAGG + Intronic
998134914 5:139669460-139669482 TGTCACTTGCAGATGGCGGAGGG - Intronic
1000679940 5:164171071-164171093 TCAGACTTGCTGATGTTGTCAGG + Intergenic
1001385691 5:171336651-171336673 TGTTACTCGCTGATGGAGGCTGG + Intergenic
1003309930 6:4961698-4961720 CCTCACTTGATGTTGGTGGGAGG - Intergenic
1004386805 6:15180158-15180180 TCTCACTTTCTCATGCAGGCTGG + Intergenic
1005294597 6:24413077-24413099 TCTCACTGGCTGGTGCTAGCTGG - Intronic
1007274206 6:40661523-40661545 ACTCAGTGGCTGATGGTGGGTGG + Intergenic
1008072352 6:47110432-47110454 TCTCACTTGGTCATGAAGGCTGG - Intergenic
1009722477 6:67490087-67490109 TCTCATTTTCTGATGGTTACTGG - Intergenic
1009969641 6:70613327-70613349 TCTGACTAGCTGAGGGTGGTAGG + Intergenic
1010869456 6:81020140-81020162 TGCCATTTGCTGATTGTGGCTGG + Intergenic
1011157006 6:84344147-84344169 GCTCATTTTCTCATGGTGGCAGG + Intergenic
1017867850 6:158460017-158460039 TTTCATTTCCTGATTGTGGCAGG + Intronic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019219892 6:170464855-170464877 TCACACCTGCTGGTGGTGGAGGG + Intergenic
1022220491 7:28309173-28309195 TCTCACATGATAATGGAGGCTGG - Intronic
1022330458 7:29374217-29374239 TCTCACTCACTGATGCTGTCAGG + Intronic
1022543876 7:31166931-31166953 TCTCACTTTCTGACACTGGCAGG + Intergenic
1026471948 7:70701226-70701248 TCTCACAAGCTGATTGTGGTGGG + Intronic
1027461891 7:78464519-78464541 TCTTACTTGCTGTTGGTTCCTGG - Intronic
1030456729 7:109783936-109783958 TCTCATTTACTGGTGGGGGCAGG - Intergenic
1032331364 7:130983528-130983550 TCCCATTTTCTGATGATGGCAGG - Intergenic
1033471039 7:141649296-141649318 TCTCCTTTGCTGATGGTGTCAGG - Exonic
1034733500 7:153408970-153408992 CCTCACTGGCTGTTGGTGGGAGG - Intergenic
1036822293 8:11950730-11950752 TCTCACTTCCTCAGGATGGCGGG + Intergenic
1037818778 8:22125584-22125606 CCGCACTTGCTGAGAGTGGCAGG + Exonic
1038037462 8:23698727-23698749 TCTAACTTGCAGATGGTATCAGG + Intergenic
1039610930 8:38918907-38918929 TCTCACTGGCAGATCCTGGCTGG - Intronic
1039664277 8:39506119-39506141 TCCCACTTGCTGACACTGGCAGG + Intergenic
1041252307 8:55946232-55946254 TATCACTTGCTGTGGGTGGCAGG - Intronic
1043463634 8:80485767-80485789 TGTCATTTGCTGAGGGTGGGTGG - Exonic
1047344619 8:124015016-124015038 TCTCACTAGCTGTTGGTTGGAGG + Intronic
1048342089 8:133548039-133548061 TGGCACCTGCTGATGGGGGCAGG + Intronic
1048662610 8:136622592-136622614 TCCCACATGCTCATTGTGGCTGG + Intergenic
1049287779 8:141785853-141785875 ACTCAGTTGCTGCGGGTGGCAGG + Intergenic
1049596430 8:143485971-143485993 GCTCACATGCTGCTGCTGGCAGG + Intronic
1049801604 8:144520299-144520321 TCCCACATGCTCATGGTGCCAGG - Exonic
1049954775 9:682248-682270 TCTCACTTTGTCATGGAGGCTGG - Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1053424074 9:37999663-37999685 TCCCACGTGCTGCTGGTGGTTGG - Intronic
1055554385 9:77460344-77460366 TCCCAGCTGCTGCTGGTGGCCGG - Intronic
1055681569 9:78721076-78721098 TCTCCCTTGCTGATGGGGATAGG + Intergenic
1056197781 9:84245354-84245376 GCTCACGTGATGATGGAGGCTGG + Intergenic
1057755389 9:97831220-97831242 TATCACATGCTGATGATGGCAGG + Intergenic
1058647445 9:107143676-107143698 TCTCACTTGCTGTTGATGTTGGG - Intergenic
1059467356 9:114477508-114477530 TCTAACTTGCAGAAGGGGGCAGG - Intronic
1059969063 9:119645885-119645907 TGTCACTTGCTGATAGTGTTAGG - Intergenic
1190561901 X:51694723-51694745 ACTCACGTGATGATGGAGGCTGG + Intergenic
1190771495 X:53518489-53518511 TTTCCCTTGCTGAAGGTGACAGG - Intergenic
1193826190 X:86230310-86230332 ACTCACTTGATCATGGTGGTTGG + Intronic
1198952956 X:142093831-142093853 TCCCAGCTGCTGATGGTTGCCGG - Intergenic