ID: 1125791062

View in Genome Browser
Species Human (GRCh38)
Location 15:42366041-42366063
Sequence TATCAGAGGGTGTCCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125791057_1125791062 19 Left 1125791057 15:42365999-42366021 CCCAAGTCTAGAAGATTCTCAAT 0: 1
1: 0
2: 0
3: 23
4: 208
Right 1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 229
1125791058_1125791062 18 Left 1125791058 15:42366000-42366022 CCAAGTCTAGAAGATTCTCAATA 0: 1
1: 0
2: 0
3: 21
4: 188
Right 1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 229
1125791056_1125791062 28 Left 1125791056 15:42365990-42366012 CCTTATTTTCCCAAGTCTAGAAG 0: 1
1: 0
2: 0
3: 20
4: 191
Right 1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125791062 Original CRISPR TATCAGAGGGTGTCCATGGA AGG Intronic
901122116 1:6904370-6904392 TCTCAGAGGGTGCCCTTGAAAGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902617407 1:17631301-17631323 TTTCCCAGGGTGTCCCTGGATGG + Intronic
902739392 1:18424531-18424553 AATCAAAAGCTGTCCATGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903140472 1:21335906-21335928 AATCAGTGGGTCTCCAGGGAGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904806771 1:33137734-33137756 TATCAGAGGTGGGCCAAGGAGGG - Intergenic
905874433 1:41423126-41423148 TGGCAGAGGGGGTCCCTGGAGGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910892287 1:92030275-92030297 TAGCAGTGGGTGCCCAAGGAGGG - Exonic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912979688 1:114360066-114360088 AATCAGAAGCTGTCCATGAAGGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915624507 1:157106511-157106533 GATCAGGGGGTGTCCAGGCAGGG - Intergenic
915650747 1:157308633-157308655 GGTCAGAGGCTGTCCGTGGAAGG - Intergenic
917132942 1:171761054-171761076 AATCAGAAGCTGTTCATGGAGGG + Intergenic
920576175 1:207062337-207062359 TATAAGATGATGTCCATGTAAGG - Intronic
922328178 1:224548693-224548715 TATCACAGGGTGTCCACACAGGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924096647 1:240558638-240558660 AATCACAGGGCGTCCAGGGAAGG - Intronic
924911016 1:248513424-248513446 TAACAGAGGATGCACATGGAAGG - Intergenic
924913085 1:248534616-248534638 TAACAGAGGATGCACATGGAAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064949179 10:20827917-20827939 TATCAGAGGGTGAAGAAGGAGGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069021204 10:63490310-63490332 TCTGTGAGGGTGTCCATGAAGGG - Intergenic
1069676865 10:70254941-70254963 TATCTGAGGGGGTCCAGGGAGGG - Exonic
1071960204 10:90802847-90802869 AATCAAAAGCTGTCCATGGAAGG - Intronic
1072334161 10:94382599-94382621 AATCATAAGCTGTCCATGGAAGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1077976768 11:7254723-7254745 TATCACAGGGTGGCCGTGAATGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080893143 11:36426997-36427019 GAGCAGAGGGTGGCCATGGGTGG - Intronic
1081291920 11:41336852-41336874 AATGAGATGGTGTCCATGCAAGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086424272 11:86669075-86669097 GCTCAGAGAGTCTCCATGGAAGG - Intronic
1086959352 11:92966973-92966995 TATTAGAGGGTGTGTCTGGATGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088351728 11:108897371-108897393 AATCAAAAGCTGTCCATGGAAGG + Intronic
1088549395 11:110995978-110996000 TTTTAGAGGGTGACCTTGGAAGG - Intergenic
1089972650 11:122706564-122706586 TTTCTGAGGGTGTCTGTGGAAGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091951820 12:4599184-4599206 TTCCAGAGTGTGTCCATGGCAGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092512005 12:9166927-9166949 TATCAGATGGGATACATGGAGGG - Intronic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099179055 12:79456891-79456913 TATCACAGGGTGTGCATACATGG - Intergenic
1099179952 12:79464990-79465012 TATCACAGGGTGTACCTGCAGGG - Intergenic
1105895459 13:24713584-24713606 TTTCAGAGGGTGTTTTTGGAGGG + Intergenic
1107010902 13:35669970-35669992 TATTAGGGGGTCTCAATGGAGGG + Intronic
1107568532 13:41631463-41631485 TATGACAGGGAGTCCATGTAAGG - Intronic
1109406375 13:61905571-61905593 AATCAGAAGCTGTCAATGGAAGG + Intergenic
1111674137 13:91366486-91366508 TGTCAGAGGGTTTCATTGGATGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116351534 14:43870062-43870084 TATCAACGTCTGTCCATGGAAGG + Intergenic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1120269652 14:82295624-82295646 CATGAGAGGGTGTCTCTGGATGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123163382 14:106301822-106301844 TAGCAAAGTGTGTCCATGGTGGG + Intergenic
1123769836 15:23518150-23518172 AATTAGAAGCTGTCCATGGAGGG + Intergenic
1123895187 15:24821679-24821701 TAAAAGAAGGTGTCAATGGAAGG - Intergenic
1125697095 15:41647930-41647952 TACCACAGGGAATCCATGGAGGG - Intronic
1125791062 15:42366041-42366063 TATCAGAGGGTGTCCATGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127424527 15:58841996-58842018 TATCAGAGGGTGGTGAAGGAGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1131951002 15:97681916-97681938 TCTTAGAGGGTGTACTTGGATGG - Intergenic
1133990146 16:10700188-10700210 TATCACAGGGTGTACATACATGG + Intergenic
1135144801 16:19951927-19951949 AATCAGAAGCTGTCCATGGAGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139205170 16:65021915-65021937 AATCAAAAGCTGTCCATGGAGGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140714975 16:77714975-77714997 TATCACAGGGTGTCCACACAGGG - Intergenic
1140838354 16:78816160-78816182 TATCAGAGGGGGTCCAGTTAGGG - Intronic
1141154883 16:81590344-81590366 TGTCAGAGGGTGTCCAAAGGAGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1145784047 17:27582711-27582733 GCTGAGAGGGTGTCCGTGGAAGG - Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146616299 17:34359750-34359772 TCTCAGTGGGTGTCCAGGCATGG - Intergenic
1151775284 17:76197067-76197089 TATCAGATGTTGTCTATGGATGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1155343421 18:24835799-24835821 TTTCAGAAGGAGTCCTTGGAGGG + Intergenic
1162402077 19:10452773-10452795 TCTCTGGGTGTGTCCATGGAGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162808521 19:13151167-13151189 TATCTGAGGGAGTCCTCGGAGGG + Intronic
1166124060 19:40703271-40703293 TCTCAGAGGGTGTGCATGCAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166262615 19:41651656-41651678 AATCAGAAGCTGTCCATGAAAGG + Intronic
1167007542 19:46785722-46785744 TATGGGACAGTGTCCATGGATGG + Intronic
1167230247 19:48278378-48278400 GATCAGAGGTTGTCCAGGGCTGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168625000 19:57911100-57911122 CAGCAGAGGGTGGTCATGGATGG + Intronic
925123838 2:1439739-1439761 CATCAGAGGGTCTCCATGTCTGG - Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927080495 2:19625015-19625037 TACCAGACGGTGTCAATGGAAGG - Intergenic
927912201 2:26907634-26907656 CAGCATGGGGTGTCCATGGAGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928664462 2:33536931-33536953 TAGCAGTTGCTGTCCATGGATGG + Intronic
928884981 2:36138072-36138094 TCTCAGAGGGAGTTCATGCATGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
934634088 2:95966460-95966482 GATCAGATGGTGTCGATGTATGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936052217 2:109233124-109233146 TAGCAGTTGCTGTCCATGGATGG + Intronic
936485697 2:112923729-112923751 TATCAGAGCGGCTCCATGCAGGG + Intergenic
936768746 2:115886127-115886149 TATAAGATGGTGTCCAAGGTAGG + Intergenic
938228195 2:129635875-129635897 TACAGGAGGGTGGCCATGGAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939667115 2:144965629-144965651 TAGCAGAGGTTATCCATGAAGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941764862 2:169285619-169285641 GATCAGAGGGTGGCCAAGGGGGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947128813 2:226900061-226900083 TTTAAGAAGGGGTCCATGGATGG + Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
1168752628 20:293992-294014 TCTCAGTGGGTGTCCATGCTGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169587599 20:7103706-7103728 TATCATAGAGTATACATGGAAGG - Intergenic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1173621963 20:44443592-44443614 TATCAGAAGGTGTTAATGGAAGG - Intergenic
1174192070 20:48747715-48747737 GCTCAGAGGGTGTGCATGCAGGG - Intronic
1176064050 20:63185206-63185228 TGTCAGTGTGTGTCCATGGTAGG + Intergenic
1176064095 20:63185545-63185567 TGTCAGTGTGTGTCCATGGTAGG + Intergenic
1176064111 20:63185697-63185719 TATCAGTGCGTGCCCATGGTAGG + Intergenic
1176064116 20:63185735-63185757 TGTCAGTGTGTGTCCATGGTAGG + Intergenic
1179794621 21:43775912-43775934 TCTCAGAGACTGTCCATGCAGGG + Intronic
1180031214 21:45209592-45209614 TGACAAAGGGTGACCATGGAGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184103582 22:42354447-42354469 TATAAATAGGTGTCCATGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
950801190 3:15552895-15552917 ACTCAGCTGGTGTCCATGGAGGG - Intergenic
953176704 3:40560076-40560098 AATCAGAAGCTGTCCATGGAGGG + Intronic
953580140 3:44146211-44146233 TACCAGAGAAGGTCCATGGAGGG + Intergenic
954099682 3:48359937-48359959 TACCAGAGGGTGGGCATTGAGGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
957437606 3:80199207-80199229 GATCAGACAGTGTCCATGTAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960992849 3:123323100-123323122 TCCCAGAGGCTGTCCATTGATGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971185766 4:24374399-24374421 TATCAGAGGGTGGGGGTGGAAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975756206 4:77573832-77573854 AATCAGAAGCTATCCATGGAGGG - Intronic
977399965 4:96520496-96520518 GATCAGAAGTTGTCCAAGGAAGG + Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979952082 4:126906022-126906044 TAGCAGCGGGTGTGCAAGGAAGG - Intergenic
980519970 4:133918965-133918987 TATCAGAGGGTCTCAATGCCTGG + Intergenic
980871499 4:138615939-138615961 TAGCAGTTGCTGTCCATGGATGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984389686 4:179112888-179112910 TGTGAGAGTGTGTCCATGTATGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985607719 5:867306-867328 TAGCAGAGGTTCTCCATGAAGGG - Intronic
986262556 5:6161039-6161061 TGCCAGAGGATGGCCATGGATGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
997686390 5:135790768-135790790 TATCACAGGGTGTACATACATGG - Intergenic
997688011 5:135802248-135802270 TATCACAGGGTATACATGCATGG - Intergenic
1001020504 5:168178542-168178564 TGTCAGAGGCTGTCCAAGGTGGG + Intronic
1001594922 5:172892113-172892135 TATCAGACCATGTCCCTGGAGGG - Intronic
1002196534 5:177504458-177504480 TCTCCGGGGGTGTCCAGGGAGGG + Exonic
1007142433 6:39589259-39589281 TTTGATAGGGTGTCCAGGGAAGG - Intronic
1007324521 6:41049811-41049833 GATCAGAGGGCCTCCAGGGATGG + Intronic
1007994162 6:46288468-46288490 CCTCAGAGGGTATCCATAGAGGG - Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009031869 6:58068979-58069001 AATCAAAAGCTGTCCATGGATGG + Intergenic
1009207698 6:60823430-60823452 AATCAAAAGCTGTCCATGGATGG + Intergenic
1009504498 6:64458767-64458789 GATCAGAGGATTTCCATGGAGGG - Intronic
1009688442 6:66993472-66993494 TATCAGATGGTTTCTGTGGAAGG + Intergenic
1010490064 6:76465204-76465226 TAGCAGTGGGTGTCCTTAGATGG - Intergenic
1012841854 6:104338967-104338989 TCTCAAAGCGTGTCCATGGGAGG - Intergenic
1013081185 6:106814780-106814802 AATCAGAAGCTGTCCATGGAGGG - Intergenic
1014135639 6:117885874-117885896 TATTAGAGGATGTACATGTATGG + Intergenic
1014183355 6:118408405-118408427 TAGCAGAGCGTGGCCAGGGATGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020599484 7:10254054-10254076 GATCAGTGGTTGTCCAGGGATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021859889 7:24895733-24895755 AATTAGAGGTTTTCCATGGAAGG - Intronic
1024381492 7:48702046-48702068 TATCATATGATGCCCATGGAAGG - Intergenic
1025229273 7:57189642-57189664 TATAAGAGTGTGGTCATGGAAGG - Intergenic
1025731065 7:64108400-64108422 TATAAGAGTGTGGTCATGGAAGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027419966 7:78009225-78009247 AATCAGAAGTTGTGCATGGAGGG - Intergenic
1028001226 7:85500865-85500887 CATCAGAAGCTGTCCATGGAGGG - Intergenic
1029302474 7:99592989-99593011 TATCACAGGGTGTACATCCACGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035022299 7:155806904-155806926 TCCCAGAGGGTGCCCCTGGAGGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046950461 8:120015318-120015340 TATCACAGGGTATTCAAGGAAGG - Intronic
1047887022 8:129262684-129262706 TATCAGAGGGTATGCAGGGGTGG + Intergenic
1049507365 8:143010352-143010374 AATCAGAAGCTGTCCATAGAGGG + Intergenic
1049908600 9:243764-243786 TCTCAGAGTGTGTCAATGAAAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1053213601 9:36252851-36252873 TATCATAGTTTATCCATGGAAGG - Intronic
1056866391 9:90230393-90230415 CATCACAGGGTGTCCATCCATGG + Intergenic
1058973162 9:110101458-110101480 TATCAGTAAGTCTCCATGGATGG + Intronic
1061691954 9:132340452-132340474 TATCAGGCGGTGCCTATGGAAGG + Intronic
1185966495 X:4611144-4611166 TATCAGAGGCTGTGCTTGGAAGG - Intergenic
1186767491 X:12785879-12785901 TAGGAGAGGCTGTGCATGGATGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188582291 X:31728823-31728845 TACCAGTGTGTGTCCCTGGAGGG + Intronic
1189381651 X:40506649-40506671 TTTCAGAGGTTGCCCAGGGAAGG - Intergenic
1189617527 X:42799166-42799188 TATCAGAGTGTGCTCTTGGATGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190136330 X:47802628-47802650 AATCAGAAGCTGTCCATGGAAGG + Intergenic
1190522381 X:51293678-51293700 TATCAGAGAGTGTGGATGGTGGG + Intergenic
1190525617 X:51326872-51326894 TATCAGAGAGTGTGGATGGTAGG + Intergenic
1190543866 X:51504782-51504804 TATCAGAGAGTGTGGATGGTGGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1193366822 X:80644281-80644303 ACTCAGATGGTGTCCATGGAGGG - Intergenic
1196703677 X:118698247-118698269 TATGAGAGGCTCTCTATGGAGGG - Intergenic
1197244656 X:124155485-124155507 TATCAGAAGCTGTCCCTGGAGGG - Intronic
1197846026 X:130804083-130804105 TACCAGAGGGTGGGCAGGGAAGG - Intronic
1198242704 X:134800930-134800952 AATAAGAAGCTGTCCATGGAGGG + Intronic
1199718510 X:150525078-150525100 TACCAGAGGTTGTCCCTGGGTGG + Intergenic