ID: 1125792175

View in Genome Browser
Species Human (GRCh38)
Location 15:42375222-42375244
Sequence CAGTTTCCGGGAGAGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125792175 Original CRISPR CAGTTTCCGGGAGAGTTCTG TGG Intronic
901629817 1:10642631-10642653 CAGTTTCCGGGAGAGGACCCTGG - Intronic
908825618 1:68130245-68130267 CAGATTCCGGGAGAGATCGGAGG + Intronic
909120356 1:71595525-71595547 GATTTTCCTGGAGAGTTCTGGGG + Intronic
915736048 1:158085975-158085997 CAGTCTGGGAGAGAGTTCTGAGG + Intronic
920914913 1:210251779-210251801 CATTCTCCGGGCGAGTCCTGCGG - Intergenic
921360844 1:214329866-214329888 CAGTGTCCTGGAGGGTTCAGAGG - Intronic
1064591707 10:16899108-16899130 CTGTTTTCGGGAAAATTCTGAGG + Exonic
1066214279 10:33270791-33270813 CATTTTAGGGGAAAGTTCTGTGG - Exonic
1069765984 10:70860546-70860568 CAGTTTCCCTTAGAGTACTGAGG + Intronic
1070012931 10:72494334-72494356 CAGTTTCTGGCAGACTTCTAGGG + Intronic
1077482902 11:2824906-2824928 CAGGTTCCCAGTGAGTTCTGGGG + Intronic
1077531404 11:3097406-3097428 CACATTCATGGAGAGTTCTGGGG - Intronic
1083056687 11:59828177-59828199 CAGTTTTAGGAAGTGTTCTGTGG + Intergenic
1084035512 11:66507588-66507610 GAGTATCCGGGAACGTTCTGGGG + Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1086851895 11:91819341-91819363 CAGTTTCCGGAGTAGCTCTGAGG - Intergenic
1087993627 11:104776867-104776889 CAATTTCAGGCAAAGTTCTGGGG + Intergenic
1089856590 11:121550582-121550604 CAGCTACCGGAAGATTTCTGGGG + Exonic
1092231919 12:6780719-6780741 GGGTTTCCTGGAAAGTTCTGTGG + Intergenic
1092740180 12:11620661-11620683 GATTTTCAAGGAGAGTTCTGTGG - Intergenic
1098000241 12:65933972-65933994 GAGTTTACAGAAGAGTTCTGTGG - Intronic
1099768394 12:87020719-87020741 CAGTCTCAGGGAGAAGTCTGGGG - Intergenic
1100837351 12:98579088-98579110 CCGCTTCAGGGAGAGTTCTCTGG + Intergenic
1101809185 12:108092968-108092990 CACTTTCATGGAGAGTTCTAAGG - Intergenic
1102546571 12:113661481-113661503 CAGTGAGGGGGAGAGTTCTGTGG + Intergenic
1104571928 12:129933518-129933540 CCGTGTCCAGGGGAGTTCTGGGG - Intergenic
1109171542 13:59104134-59104156 CTGTTTTCTGGAGATTTCTGTGG - Intergenic
1110687148 13:78388588-78388610 GAGTTGCTTGGAGAGTTCTGGGG + Intergenic
1112132963 13:96543712-96543734 CACTTTCCTGGAGAGTTATTTGG - Intronic
1112804924 13:103154101-103154123 CAGGTTCCCAGAGAGTTATGGGG + Intergenic
1113005505 13:105697398-105697420 CTGTTTCAGGGAAAGTTTTGTGG - Intergenic
1115323348 14:32109859-32109881 CAGTTTTCCGGAGAACTCTGAGG + Intronic
1119482085 14:74964254-74964276 GAGTGTTCGGGAGACTTCTGAGG + Intergenic
1202915376 14_GL000194v1_random:165736-165758 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1202853395 14_GL000225v1_random:35970-35992 CAGTTCCCGGGAGATTCCTGGGG + Intergenic
1125444373 15:39737348-39737370 CAGTTCCCTGGAGAGTCCTGGGG - Intronic
1125792175 15:42375222-42375244 CAGTTTCCGGGAGAGTTCTGTGG + Intronic
1129241698 15:74255860-74255882 CTATTTCCAGGACAGTTCTGAGG + Intronic
1129738272 15:77977575-77977597 CACTTTCAAGGAGTGTTCTGGGG + Intergenic
1129847802 15:78776018-78776040 CACTTTCAAGGAGTGTTCTGGGG - Intronic
1130254101 15:82317897-82317919 CACTTTCAAGGAGTGTTCTGAGG + Intergenic
1130600870 15:85272074-85272096 CACTTTCAAGGAGTGTTCTGAGG - Intergenic
1131844445 15:96473618-96473640 CAGTTACCGGGAGGATGCTGGGG + Intergenic
1139244905 16:65432229-65432251 CAGGTTCCAGGTGAGTTCTAGGG - Intergenic
1142183627 16:88684165-88684187 CAGCGTCCAAGAGAGTTCTGGGG + Intronic
1143847142 17:9781085-9781107 CACTTCCTGGGAGAGTTCTTGGG + Intronic
1147548035 17:41418429-41418451 CAGTCACCGAGAGAGCTCTGGGG - Intergenic
1149117402 17:53114095-53114117 CAGCTTCAGTGAGAGTCCTGTGG + Intergenic
1156208681 18:34914186-34914208 AATTGTCCGGGAGAGTTCTCAGG + Intergenic
1166571795 19:43801928-43801950 CAGTTTCGGAAAGAGTCCTGAGG + Intronic
925307193 2:2856899-2856921 TACCTTCCTGGAGAGTTCTGAGG - Intergenic
926212314 2:10880252-10880274 CATTTTCAGAAAGAGTTCTGAGG - Intergenic
926530051 2:14033029-14033051 CAGCTCCCTGGAGAGGTCTGTGG + Intergenic
927827177 2:26316979-26317001 CAGTGTCCTGGAGAGTTCAGGGG + Exonic
928021399 2:27707942-27707964 CAGGTTCCAGGCCAGTTCTGGGG - Exonic
936242787 2:110802291-110802313 CAGCTTCCAGGTGTGTTCTGGGG + Intronic
939556445 2:143679836-143679858 CAGTATCAGGGAGAGATCTCAGG + Intronic
941004956 2:160238392-160238414 CTGTTTCCAGGACAGTGCTGCGG + Intronic
941589796 2:167405473-167405495 CAGTTTCCTGGAGTGTTATTAGG + Intergenic
942254619 2:174084319-174084341 CACTTTACGGGAGAGTGCTACGG - Intronic
944321632 2:198351381-198351403 CAGTTTCAGGGAGAATTCAATGG - Intronic
946129375 2:217594001-217594023 CAGTCCCGGGGAGAGGTCTGAGG + Intronic
948407314 2:237731906-237731928 CAATTTCCAGGAAGGTTCTGAGG - Intronic
1170174554 20:13454341-13454363 TAGTTTCAGGGAGAGTTCCTTGG + Intronic
1174331852 20:49826149-49826171 CACTTCCAGGGAGAGTGCTGAGG + Intronic
1176189665 20:63802564-63802586 CGGTTTCTGGGAGGGTGCTGGGG - Intronic
1176634726 21:9180380-9180402 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1178474281 21:32922721-32922743 CAGTTTCCCTGAGGGTTCTCAGG + Intergenic
1181693997 22:24583919-24583941 GAGTTTCAGGGAGAGCTCAGAGG + Intronic
1182756499 22:32683897-32683919 CAGTTTCTGGGAGAATTCTTAGG + Intronic
949869391 3:8574965-8574987 CAGTTGACAGGAGAGCTCTGCGG + Intergenic
951171262 3:19544571-19544593 CGGTTTCCTGAAGAGTTTTGAGG - Intergenic
966961642 3:184945810-184945832 CAGTTTCCTGGAGAACTCAGAGG + Intronic
969478123 4:7432736-7432758 CATTTCCGGGGAGAGGTCTGGGG - Exonic
974303940 4:60107032-60107054 CAGTTTCCTGGAGAATTCTTAGG + Intergenic
977689313 4:99887495-99887517 CAATTTCTGGGAGAATTTTGGGG - Intronic
979214927 4:118151765-118151787 CAGTTTAAGGTAGAGTTCTCTGG - Intronic
979621646 4:122805035-122805057 CAGTTCTTGGGAGAGTGCTGTGG + Intergenic
981049757 4:140298314-140298336 CAGTCTCTTGGAGATTTCTGAGG - Intronic
981402482 4:144329732-144329754 CCTTTTCTTGGAGAGTTCTGGGG - Intergenic
986024679 5:3839569-3839591 CAGTTTCCAGGAAAGTTGTGTGG - Intergenic
987236145 5:15943789-15943811 CAGATTCTGGGAGACTCCTGGGG - Intergenic
995550795 5:113279116-113279138 CAGTTGTGTGGAGAGTTCTGAGG - Intronic
997239049 5:132293951-132293973 CGGTTCCCGGGAAACTTCTGGGG - Intronic
1000333124 5:160221476-160221498 CAGTCTCCTGGAGTCTTCTGGGG - Intronic
1001566307 5:172701620-172701642 CACTTTTTGGGAGGGTTCTGGGG + Intergenic
1001953255 5:175830670-175830692 CTGTTTCCAGGAAAGCTCTGGGG - Intronic
1005622240 6:27630853-27630875 CAGGCTCTGGGAGAGTTTTGGGG + Intergenic
1007986413 6:46211590-46211612 TAATTTCCAGGAGATTTCTGGGG + Intergenic
1009245555 6:61232446-61232468 CAGTTTCTGGGAGAATTCTCTGG - Intergenic
1017359730 6:153553868-153553890 GGGTTTCAGAGAGAGTTCTGAGG + Intergenic
1018477457 6:164157793-164157815 CTGTTTCCAGCAGAGTTCTTAGG - Intergenic
1023702636 7:42907531-42907553 CAGTTTCCTAAAGAGTGCTGTGG + Intergenic
1023764878 7:43501307-43501329 CTGTTACCTGGGGAGTTCTGAGG - Exonic
1024410958 7:49040080-49040102 CATATTCCGGGAGAATTCTCTGG - Intergenic
1028470765 7:91204174-91204196 AAGTTTCCAGGAGAGGCCTGGGG - Intronic
1029440043 7:100582443-100582465 CCGGTTCCGGGACAGGTCTGGGG + Exonic
1030844656 7:114394044-114394066 CAGTTTCCGGGACCTTTCAGCGG - Intronic
1031070625 7:117157380-117157402 CAGATTCCAGGAGGGTTCAGTGG + Intronic
1033366961 7:140679015-140679037 GAGTTTCTGGGCAAGTTCTGCGG + Intronic
1033570015 7:142618507-142618529 CAGTTTCCCTGAGAGAGCTGAGG + Intergenic
1035438178 7:158874984-158875006 CAGTCTCTTGGAGAGTCCTGGGG + Intronic
1040785114 8:51156529-51156551 GAGTTCCCAGGAGGGTTCTGGGG + Intergenic
1046070136 8:109241625-109241647 CAGTTTCCTAGAGAGTATTGAGG - Exonic
1047201705 8:122772804-122772826 CATTTCCAGGTAGAGTTCTGGGG - Intergenic
1048736271 8:137505382-137505404 GAATTTCCTGGAGAGTTCTGTGG - Intergenic
1049202191 8:141345841-141345863 CAGATTCCTGGAGAGGTCGGTGG - Intergenic
1049428395 8:142547923-142547945 CAGTTTCGTGGACAGATCTGGGG + Intergenic
1058638540 9:107060272-107060294 CAGATCCCAGGAGAGCTCTGAGG + Intergenic
1060899017 9:127241141-127241163 CAGTTTCAGGCAGAGCCCTGCGG - Intronic
1062045900 9:134424345-134424367 CTCTTTCCGGGAGATCTCTGCGG + Intronic
1062318800 9:135980573-135980595 CAGACTCGGGGAGAGTGCTGGGG + Intergenic
1203757507 Un_GL000218v1:147689-147711 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1187346580 X:18470795-18470817 CTTTTTTCTGGAGAGTTCTGTGG + Intronic
1188261955 X:28033448-28033470 AAGTTTCCGGAAGAGCCCTGGGG + Intergenic
1188262454 X:28036656-28036678 AAGTTTCCGGAAGAGCCCTGGGG - Intergenic
1190689715 X:52903380-52903402 CAGTTCCAGGGAGTGTCCTGCGG - Intronic
1190696268 X:52952412-52952434 CAGTTCCAGGGAGTGTCCTGCGG + Intronic
1194546492 X:95240625-95240647 CAGGATCCGGGAGAATTCTCTGG - Intergenic
1194791926 X:98160677-98160699 CAAGTTCCGGGAGAATTCTCTGG - Intergenic
1199331215 X:146561901-146561923 CAAGTTACAGGAGAGTTCTGAGG + Intergenic
1200329940 X:155284903-155284925 AAATTTCAGTGAGAGTTCTGTGG - Intronic