ID: 1125794930

View in Genome Browser
Species Human (GRCh38)
Location 15:42397071-42397093
Sequence AGGACCAGGCCAACATGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125794924_1125794930 2 Left 1125794924 15:42397046-42397068 CCAGGCCACAGGGACAACTGAGC 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1125794930 15:42397071-42397093 AGGACCAGGCCAACATGACATGG 0: 1
1: 0
2: 0
3: 16
4: 139
1125794923_1125794930 6 Left 1125794923 15:42397042-42397064 CCTTCCAGGCCACAGGGACAACT 0: 1
1: 1
2: 2
3: 22
4: 214
Right 1125794930 15:42397071-42397093 AGGACCAGGCCAACATGACATGG 0: 1
1: 0
2: 0
3: 16
4: 139
1125794925_1125794930 -3 Left 1125794925 15:42397051-42397073 CCACAGGGACAACTGAGCCCAGG 0: 1
1: 0
2: 1
3: 34
4: 302
Right 1125794930 15:42397071-42397093 AGGACCAGGCCAACATGACATGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125794930 Original CRISPR AGGACCAGGCCAACATGACA TGG Intronic
900300025 1:1972422-1972444 AGGGCCAGGCCACGAGGACATGG + Intronic
900585027 1:3428539-3428561 AGGACCAGGCCAGCTGGACCCGG - Intronic
901209599 1:7517260-7517282 ATAACCAGACCAACATGAAAAGG - Intronic
904404446 1:30276817-30276839 AAGTCCAGGCCAGAATGACAGGG + Intergenic
905231036 1:36515127-36515149 GCGACCAGGGGAACATGACATGG + Intergenic
905586873 1:39126938-39126960 GGCACCCGGCCAACAGGACAAGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906782214 1:48582858-48582880 AGCACCAGCCAAACATGACCAGG - Intronic
908453924 1:64283485-64283507 AGAACAATGCGAACATGACATGG - Intergenic
910802119 1:91157465-91157487 GGGACCAGGCCAGCTTGGCATGG - Intergenic
916548979 1:165831517-165831539 AGGAACAGGCAAAGATGAAAAGG - Intronic
917956567 1:180105272-180105294 AGGAGCATGCCAACATTTCAAGG - Intronic
920136589 1:203774281-203774303 ATGACTATGTCAACATGACAGGG + Exonic
920140289 1:203806109-203806131 AGGACCAGATCAAGATGAGAGGG - Intronic
921496778 1:215852456-215852478 GGGACCAGGGCAGCATGATATGG - Intronic
923768769 1:236918295-236918317 CCGACCTGGCCAACATGGCAAGG - Intergenic
1063923934 10:10958873-10958895 AGGGCCACGACAACATCACAAGG + Intergenic
1065900706 10:30205195-30205217 TGGTCCAGGCCAACATTACTGGG - Intergenic
1067466595 10:46503634-46503656 GGGCCCAGGCCATCATGGCAAGG - Intergenic
1067620593 10:47880971-47880993 GGGCCCAGGCCATCATGGCAAGG + Intergenic
1069663020 10:70136303-70136325 GGGACCAGGCTAACAGGACATGG + Intergenic
1072538532 10:96381195-96381217 AGGACCAGGGCAGCAGGGCAGGG - Intronic
1075056158 10:119220146-119220168 AGGAAGAGGCCAACATGATGAGG + Intronic
1080652388 11:34233052-34233074 AGGACCAAACCACTATGACAGGG - Intronic
1082167210 11:48963452-48963474 AGGACCAGGCCCACAGAAAAAGG + Intergenic
1085762783 11:79256642-79256664 AGGTCCAGACAAACCTGACATGG - Intronic
1086106066 11:83148637-83148659 AGTTCCAGGCCAACATCTCAAGG + Intergenic
1089729328 11:120510979-120511001 GGGACCAGGCCAAGAACACACGG - Intergenic
1090743159 11:129684907-129684929 ATGTCCATGCCATCATGACATGG + Intergenic
1091277587 11:134362817-134362839 AGGACCTGGTCACCATGAGATGG - Intronic
1097915638 12:65018042-65018064 AGGACCAGGCCAAAATGAGGAGG + Intergenic
1101649404 12:106661131-106661153 AGGACCTGCCCATCATCACATGG - Intronic
1103478935 12:121238505-121238527 AGGACCTGCCCCACATGAAAAGG - Exonic
1104589081 12:130070007-130070029 AGGTCAAGGCCAACCTGCCAAGG - Intergenic
1108157696 13:47603386-47603408 AGGAACAGGAAAACATGACCAGG + Intergenic
1113594291 13:111520435-111520457 GGGACCAGGAGAACAAGACACGG + Intergenic
1117793204 14:59362665-59362687 AGGCCCAGAGCAACATGCCATGG + Intronic
1118844705 14:69538668-69538690 AGGACCAAGCCAGCATGTCTGGG + Intergenic
1119157358 14:72423296-72423318 AGGGCCAGGTAAACATGACATGG - Intronic
1121622614 14:95360840-95360862 TGGACCTGGCCAACCTGAGAAGG + Intergenic
1121743747 14:96271787-96271809 AGCACAAGGCCAACATCAGATGG + Intergenic
1122367078 14:101200652-101200674 AGGGCCAGGCCTCCAGGACATGG + Intergenic
1125794930 15:42397071-42397093 AGGACCAGGCCAACATGACATGG + Intronic
1126408853 15:48351054-48351076 AGGACCAGGTCAGCCTGGCATGG - Intergenic
1128062474 15:64743580-64743602 GGGGCCAGGCCAGCAAGACAGGG + Intronic
1129133826 15:73527943-73527965 AGGACAGGGCCAACTTGAAAAGG + Intronic
1130882913 15:88070465-88070487 AGGAGCAGAGAAACATGACAAGG + Intronic
1135358814 16:21793538-21793560 AGCACCACCCCAACATCACACGG - Intergenic
1135457370 16:22609974-22609996 AGCACCACCCCAACATCACACGG - Intergenic
1137751500 16:50864291-50864313 GGGACAGGGCCACCATGACAAGG + Intergenic
1138066049 16:53942374-53942396 AAGACCAGGACAAAAAGACATGG + Intronic
1144995273 17:19263852-19263874 AGGACCAGGCCAAGAAAACAGGG - Intronic
1150136974 17:62701447-62701469 AGCACCAGGCCAGCCTGCCAGGG + Exonic
1150506028 17:65700046-65700068 AGGAGGAGGACAGCATGACATGG - Intronic
1150755615 17:67909706-67909728 AGGAGCAGACCAAAATGAAATGG + Exonic
1152691919 17:81722276-81722298 AGGAAGCGGCCATCATGACAGGG + Intergenic
1152805295 17:82352883-82352905 AGGGTGAGGCCAGCATGACATGG + Intergenic
1153582738 18:6591310-6591332 AGGACCTGGCAAACTTGAGATGG + Intergenic
1153835252 18:8958116-8958138 AGGACCAGATCATCATGACATGG + Intergenic
1154326058 18:13391175-13391197 AGGGCCAGGCAAACATCACTGGG + Intronic
1159310605 18:66702630-66702652 AACACCAGGCCAACAAGGCATGG + Intergenic
1162684649 19:12371878-12371900 AGGAACAGGCAAACATTTCATGG + Intergenic
1162838725 19:13340105-13340127 AGGAGCAGGCTCAGATGACAGGG + Intronic
1164391327 19:27823780-27823802 AGGAGCAGGGCAACAAGCCAAGG - Intergenic
1165914056 19:39247329-39247351 AGGACCAGGCGAGGCTGACAAGG - Intergenic
1167054129 19:47098124-47098146 AGGAACAGGCCAACTCCACAGGG + Intronic
1167304762 19:48701372-48701394 CCAACCTGGCCAACATGACAAGG - Intronic
927191586 2:20520559-20520581 AGGAACAAGCCAACATAGCAAGG + Intergenic
928080684 2:28309810-28309832 AGGCCCAGGCCAACATAGCTCGG + Intronic
928412531 2:31066104-31066126 AGGAGGAGGCATACATGACAGGG + Intronic
928565297 2:32539625-32539647 ACGATAATGCCAACATGACATGG + Intronic
932795182 2:74688473-74688495 AGTAACAGGCTAACATTACAAGG + Intergenic
935984419 2:108658923-108658945 AGGATCAGACCAACATCACAAGG - Intronic
936136856 2:109902571-109902593 AGGATCAGACCAACATCACAAGG - Intergenic
936207841 2:110468914-110468936 AGGATCAGACCAACATCACAAGG + Intronic
937340380 2:121087223-121087245 AACACCAGGCCCACATCACATGG + Intergenic
940067384 2:149645229-149645251 AGGACTACACCAACATGAAAAGG + Intergenic
948791645 2:240381636-240381658 AGGCCCAGGCCAGGATGAGAAGG + Intergenic
1169315452 20:4587052-4587074 ATTCCCAGGCCATCATGACATGG - Intergenic
1171246187 20:23611613-23611635 AGGACCAGGCCCTCAGGAGATGG + Intergenic
1172153754 20:32809410-32809432 AGGGCCTGGCTAACATGTCAGGG + Intergenic
1172216216 20:33237663-33237685 ATGACAAGTCCAACATGGCATGG - Intronic
1175228775 20:57460644-57460666 AGGACCAGGCCCCCATCACAGGG - Intergenic
1175905473 20:62377539-62377561 AGCTCCAGGCCTGCATGACAAGG - Intergenic
1182121952 22:27793678-27793700 AAGTCTAGGCCAACATCACATGG - Intronic
1182662684 22:31936165-31936187 AGGACCAGCACAACCTGAAATGG - Intronic
1183620526 22:38969461-38969483 AGGACCATGCCACCATGCCTGGG + Intronic
1184349217 22:43932576-43932598 AGGACTTGGCCAACACAACATGG + Intronic
1184908462 22:47508967-47508989 AGGACATGGCCAACCTGGCATGG - Intergenic
1185089627 22:48758459-48758481 AGGTCCAGGCCAACAGGGCCGGG - Intronic
949831497 3:8219701-8219723 AGGACCATGCCAACAAGAGAGGG + Intergenic
950004859 3:9685146-9685168 ATGACAAGGCCAAGAGGACAGGG - Intronic
950135660 3:10579104-10579126 AGGACCAGGCCTACCTCCCAGGG + Intronic
950685329 3:14613539-14613561 ATGACCAAGCCATCAGGACAAGG + Intergenic
952671174 3:35971328-35971350 AGGACCAGGACAAGGGGACAAGG - Intergenic
953439856 3:42907961-42907983 AGGACCAGGCCAAGAGGAAGGGG - Intronic
956885363 3:73553756-73553778 AGGAGTAGGCCAAGGTGACAGGG + Intronic
959599375 3:108162525-108162547 AGGAGAAGTCCAACATGACTAGG - Exonic
960441830 3:117698003-117698025 AGGCCCAGGGCAACATTACAAGG + Intergenic
960988792 3:123297220-123297242 AGGAGAAGGCCAACAGGACAGGG - Intronic
964345738 3:155752956-155752978 AGGTCCTGGTCAAAATGACAAGG + Intergenic
964762283 3:160145858-160145880 AGGAGCAGGCAGACAGGACACGG - Intergenic
964878599 3:161398248-161398270 TGAACCAGGCTTACATGACAGGG - Intergenic
968975083 4:3817926-3817948 AGGACCAGACATACATGAAAAGG - Intergenic
969505697 4:7586026-7586048 AAGACAAGGTCAACATGAAAAGG - Intronic
969708278 4:8826464-8826486 AGGCTCATGCCACCATGACAGGG - Intergenic
973308993 4:48686540-48686562 AGGACCGTGCCCACAAGACATGG - Intronic
974447898 4:62010229-62010251 AGGACCAAGCTAACATTAAAAGG - Intronic
978844295 4:113253601-113253623 AAGAAGAGTCCAACATGACATGG - Intronic
987391689 5:17382116-17382138 ATGAAGAAGCCAACATGACAAGG + Intergenic
987425013 5:17763096-17763118 AGGCCCAGGTCAGCCTGACATGG + Intergenic
994812638 5:104541266-104541288 AGGAACAGGCAAACAGGACCTGG + Intergenic
995011279 5:107259550-107259572 GGGACCAGGGCAAAATGACACGG - Intergenic
995277894 5:110298323-110298345 GGGACCAGGGCAACACGAGATGG + Intronic
995833353 5:116377385-116377407 AGGTTCAGGCCAACAAGAAAGGG - Intronic
995979359 5:118082466-118082488 AGGACCAATTCAACATGAGATGG + Intergenic
997903627 5:137792263-137792285 AGGAACAGCCAAAGATGACAGGG + Intergenic
1001284054 5:170409626-170409648 AGCTCCAGGCCAAGATGACAAGG + Intronic
1001770431 5:174292085-174292107 AGGAAGAGGCCCACATGTCAAGG - Intergenic
1002894329 6:1367534-1367556 AAGACCAGGCGCACAAGACAGGG + Intergenic
1003786549 6:9493339-9493361 AGCACCAGGCCACGATGAAAGGG - Intergenic
1004398215 6:15265213-15265235 TGGATCCGGCCAACATTACAAGG - Intronic
1004403780 6:15312753-15312775 AGGACCAGGCCAGGCTTACAGGG - Intronic
1007242000 6:40432883-40432905 AGGACTTTGCCAACATGACGGGG - Exonic
1008862154 6:56161779-56161801 AAAACCAGGTCAAAATGACAAGG - Intronic
1011440832 6:87385411-87385433 CGGACTAGGCAAACATGACTCGG - Intronic
1012377435 6:98579422-98579444 TGGACCAGGCAGACATGGCAAGG - Intergenic
1012920149 6:105213350-105213372 AGGACCATGCCAACTTGCAAAGG + Intergenic
1013474309 6:110493540-110493562 AGGTGCAGGCCATCAGGACATGG - Intergenic
1017325840 6:153140500-153140522 AGGTCCAGGCCAGGATGGCAAGG - Intergenic
1018582979 6:165323855-165323877 ATGAACAGTCCAACATGGCAGGG - Intergenic
1022042802 7:26596402-26596424 AGAACCAGGCCAACATTATGGGG - Intergenic
1028410419 7:90524802-90524824 AAAACCAGACCAACATGAAATGG - Intronic
1029501008 7:100929868-100929890 AGGACCAGCCCCTCATTACATGG - Intergenic
1033629896 7:143147478-143147500 AGGAGCAGGGCAACAAGACAGGG - Intergenic
1034418221 7:150976255-150976277 AGGCCCAGGCCATCAGGACTTGG + Intronic
1037911153 8:22744384-22744406 AGCCACAGGCCACCATGACAGGG + Intronic
1037935252 8:22911246-22911268 AGTACAAGACCAACATGTCAGGG + Intronic
1041969022 8:63715505-63715527 AGGACTAGGCCAAAAGAACATGG - Intergenic
1042328880 8:67556951-67556973 AGGACCAGGGCAAGAAGACATGG - Intronic
1042926530 8:73973091-73973113 AGGGCCAAGACAACATTACAAGG + Intronic
1048048060 8:130791803-130791825 AGCAGCATGCCTACATGACAAGG - Intronic
1049034213 8:140061892-140061914 AGGCCCACTCCAACATTACAGGG + Intronic
1053034402 9:34811624-34811646 AAGACAAGGCTAAAATGACAAGG + Intergenic
1057391705 9:94646136-94646158 ACCTCCAGGCCAACATGTCATGG + Intergenic
1061404375 9:130385387-130385409 AGAACCAGGCCAGCACGCCAAGG - Intronic
1061646371 9:132005469-132005491 ATTACCAGGCCACCTTGACACGG - Intronic
1061852853 9:133426028-133426050 AGGACCAGGTCAGCATGGCCAGG - Exonic
1190278469 X:48914142-48914164 AGGACCAGGCCAAAGGGGCAGGG + Exonic
1192180095 X:68910951-68910973 AAGCCCAGGCAAGCATGACAAGG - Intergenic
1192656762 X:73001866-73001888 AGGAGCAGTCCACCATGTCAAGG - Intergenic
1192665358 X:73081135-73081157 AGGAGCAGTCCACCATGTCAAGG + Intergenic
1197502513 X:127259690-127259712 AGCACCAGGCCACCCTGACTGGG - Intergenic
1202263461 Y:22993780-22993802 AGGACCAGGTATATATGACAAGG - Intronic
1202416451 Y:24627521-24627543 AGGACCAGGTATATATGACAAGG - Intronic
1202454336 Y:25042565-25042587 AGGACCAGGTATATATGACAAGG + Intronic