ID: 1125795898

View in Genome Browser
Species Human (GRCh38)
Location 15:42403690-42403712
Sequence CAGTGTCACCAGAAGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125795898_1125795902 6 Left 1125795898 15:42403690-42403712 CCTGCTTGCTTCTGGTGACACTG 0: 1
1: 0
2: 0
3: 18
4: 288
Right 1125795902 15:42403719-42403741 CACATGTCTGTATTCCTCACAGG 0: 1
1: 0
2: 2
3: 14
4: 201
1125795898_1125795903 7 Left 1125795898 15:42403690-42403712 CCTGCTTGCTTCTGGTGACACTG 0: 1
1: 0
2: 0
3: 18
4: 288
Right 1125795903 15:42403720-42403742 ACATGTCTGTATTCCTCACAGGG 0: 1
1: 0
2: 3
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125795898 Original CRISPR CAGTGTCACCAGAAGCAAGC AGG (reversed) Intronic
900000357 1:11410-11432 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
900020071 1:181929-181951 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
901232703 1:7650073-7650095 CAGTCTTACCAGGAGCAAGATGG + Intronic
901257901 1:7847773-7847795 CAGTATTTCCAGAAGCAATCAGG + Exonic
903537117 1:24074347-24074369 CAGGCTCACCAGAAGCAACCTGG - Intronic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
905969098 1:42127403-42127425 CAGTGCTCCCAGCAGCAAGCAGG - Intergenic
906726607 1:48048925-48048947 CAGCATCACCAGAGGCCAGCGGG - Intergenic
909482212 1:76138405-76138427 CAATTTCACCAGGAGCAGGCTGG - Intronic
909830510 1:80183470-80183492 AATGGACACCAGAAGCAAGCAGG - Intergenic
910527532 1:88198009-88198031 CAATGTTACCAGAAGAAACCTGG + Intergenic
910634677 1:89394317-89394339 TAGTGACACCATAGGCAAGCTGG + Intergenic
911680493 1:100709919-100709941 TAGTGTCACCAGAAGATACCAGG - Intergenic
912586424 1:110771115-110771137 GAGTGTCACAACAAGGAAGCAGG - Intergenic
913045338 1:115069178-115069200 CTGTGACACCAAGAGCAAGCAGG + Intronic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
914444461 1:147738265-147738287 AAGTGTCCCCAGCAGCAAGGAGG - Intergenic
914985173 1:152450090-152450112 CAGTGGCACCACCAGCAAGAAGG - Intergenic
915827026 1:159088811-159088833 CAGAGTCCCCACAAGCAAGAAGG + Intronic
922236011 1:223723270-223723292 CAGTGGCTCCAGAACCAGGCTGG - Intronic
922377492 1:224983270-224983292 AATGGTCACCAAAAGCAAGCAGG - Intronic
923219477 1:231880231-231880253 CAGTGTCCCCAACAGCAAGAAGG + Intronic
923919987 1:238553063-238553085 TAGTTTTTCCAGAAGCAAGCTGG + Intergenic
924749636 1:246873994-246874016 CAGTGTCAGAAGCAGCAAGCGGG - Intronic
924885191 1:248208131-248208153 AATTGACACCAAAAGCAAGCAGG - Intergenic
1064577958 10:16765133-16765155 CATTGCCACCAGAAGAAAGATGG + Intronic
1064977416 10:21133177-21133199 AAGTGTCACAAAAAGAAAGCTGG - Intronic
1065226845 10:23552272-23552294 CAGTGTGGCCAGAATAAAGCAGG + Intergenic
1066347047 10:34597816-34597838 CACTGTCTCCAGAAGCAGGAGGG + Intronic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071339911 10:84636112-84636134 CAGAGTCATCAGCAGCAAGAAGG + Intergenic
1071673613 10:87634893-87634915 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1072351055 10:94557608-94557630 AAGAGTCACCAGAAAGAAGCAGG - Intronic
1072709169 10:97704652-97704674 CAATGTGACCAGAAGCATGGTGG + Intergenic
1073366682 10:102948545-102948567 CGAAGTCAGCAGAAGCAAGCAGG + Intronic
1075041858 10:119114422-119114444 CAGTGGCAGCAGAAGCCCGCAGG + Intronic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075228786 10:120653668-120653690 CAGACTCACCAGCAGCAAGGAGG + Intergenic
1076978055 11:190186-190208 CAGTGTCCCCAGCTGCCAGCAGG - Intronic
1078192522 11:9103737-9103759 CAGTGACCACAGAAGAAAGCGGG - Intronic
1078950207 11:16123307-16123329 CAGTTTCATCACAAGCAAGAAGG + Intronic
1080122933 11:28698114-28698136 TACTGTCACCAGATGCCAGCAGG - Intergenic
1083181119 11:60986307-60986329 CAGTCTCACCAGCAGGAAGGTGG + Intronic
1083294440 11:61707565-61707587 CAGACACACCAGAAGCATGCAGG + Intronic
1084163481 11:67364076-67364098 CAGCTCCACCAGAGGCAAGCAGG + Intronic
1085621637 11:78042125-78042147 CTGTGACACCAGAAGCAAGATGG - Intronic
1085755562 11:79198614-79198636 CGGTGTCTCTAGAAGCAGGCTGG - Intronic
1086844616 11:91732965-91732987 AATGGACACCAGAAGCAAGCAGG + Intergenic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089871881 11:121682247-121682269 CAGCATCAGCAGAAGTAAGCAGG + Intergenic
1090645238 11:128761765-128761787 CAGTCACACCAAAAGCCAGCTGG + Intronic
1091373447 12:11541-11563 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1092006192 12:5072441-5072463 CAGAGCCACTAGAAGCAAGCTGG - Intergenic
1092083228 12:5735309-5735331 CAGTCTCCCCAGGAGCCAGCTGG + Intronic
1095444530 12:42270829-42270851 CAGTATCACAGGAAGCAAGCAGG + Intronic
1096571880 12:52528117-52528139 CAGTATCACCAAAAGCAACGAGG - Intergenic
1097036699 12:56129037-56129059 GAGTGGCACCAAAAGCAAGAGGG - Intronic
1097356590 12:58608988-58609010 CTGTGTCAGCTGGAGCAAGCAGG + Intronic
1098340812 12:69449202-69449224 AAGTGTCTCCAGAAGAAAGGAGG + Intergenic
1098833102 12:75387659-75387681 CAGAGTCCCCAGTAGCAAGAAGG - Intronic
1099213584 12:79824769-79824791 CAGTGTCACTCAAAGCAACCAGG + Intronic
1099583449 12:84483844-84483866 CAGTGTGACTAGAATAAAGCAGG + Intergenic
1103496405 12:121365896-121365918 CAGTGTCACCGCACGCATGCTGG + Intronic
1106490412 13:30216485-30216507 CAGTGCCAAAAGCAGCAAGCAGG + Intronic
1107381866 13:39865197-39865219 CACTGTCCCCAGAAGCTTGCTGG - Intergenic
1108634864 13:52323287-52323309 CAGTGGCGCCAGAAGCAGTCTGG - Intergenic
1108652941 13:52499901-52499923 CAGTGGCGCCAGAAGCAGTCTGG + Intergenic
1108737685 13:53301876-53301898 CAGAGTCACCATAAACAGGCAGG - Intergenic
1109135499 13:58644835-58644857 GAGTGACACCAGAAGCAAGAAGG + Intergenic
1109274628 13:60290254-60290276 CAGCGTCAGCAGCAGCAACCAGG - Intergenic
1111148675 13:84218728-84218750 AATGGACACCAGAAGCAAGCAGG + Intergenic
1111387531 13:87546181-87546203 CAGTGTCATCATAAACATGCTGG + Intergenic
1112398021 13:99051130-99051152 CACTGTCACCTGAAGCAATGGGG + Intronic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1117881695 14:60318988-60319010 CATTGTCAGGAGAAGCAAGAGGG - Intergenic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121565363 14:94905479-94905501 CAGTCTCCCCAGAACCCAGCTGG - Intergenic
1121776589 14:96594835-96594857 CACTGTCACCAGAAGTCAGCAGG - Intergenic
1122128573 14:99592370-99592392 CATAGTCACCAGCAGCAATCTGG + Intronic
1122950631 14:105042548-105042570 CAGTGACACCACAAGGAGGCAGG + Intergenic
1124208405 15:27742601-27742623 CACTGTCTGCAGAAGCAAGCTGG + Intergenic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1125589176 15:40844047-40844069 CAGTTTCACCAGAAACCAGGGGG + Exonic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126348182 15:47718155-47718177 CAGCGTCTCCAGGAGCCAGCCGG + Intronic
1127263732 15:57344938-57344960 CACTGTCTCAGGAAGCAAGCAGG - Intergenic
1127554743 15:60076773-60076795 CAGTGTCAACAGAAAAATGCCGG + Intergenic
1128303610 15:66583097-66583119 AAGGGTGACCAGAAGCAAACTGG - Intronic
1128342413 15:66831726-66831748 GAATGTGAGCAGAAGCAAGCAGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128475738 15:67995615-67995637 CAGTGTCACTACCAGCAAGGAGG - Intergenic
1129631906 15:77269337-77269359 AATGGGCACCAGAAGCAAGCAGG + Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1132156853 15:99501852-99501874 CCGTGGCACCAGAAGCATGGAGG - Intergenic
1132423854 15:101697360-101697382 CACTGTCACCAGAAGTAACATGG + Intronic
1132453150 15:101979535-101979557 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
1132453744 16:11091-11113 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1133221492 16:4320900-4320922 CAGTGGCCCTAGAACCAAGCAGG - Intronic
1133317250 16:4892427-4892449 TAGTGACACCAGAAGCACCCAGG + Intronic
1137558462 16:49488319-49488341 CAGAGTGCCCAGAAGCAGGCAGG - Exonic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1138129450 16:54467149-54467171 GAGTGTCACCCCATGCAAGCAGG - Intergenic
1140376989 16:74452545-74452567 CTGTCTCAGCAGAAGAAAGCAGG + Intronic
1141698980 16:85633816-85633838 CGGTGTCAGCAGCAGCAGGCAGG - Intronic
1142043656 16:87911551-87911573 GAGTGGCACCGGAAGCAGGCCGG - Intronic
1142465480 17:134651-134673 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1142728050 17:1830623-1830645 GGGTGTGACCTGAAGCAAGCAGG - Intronic
1142858433 17:2746583-2746605 CAGAATCTCCAGAAACAAGCAGG - Intergenic
1143756206 17:9069626-9069648 CAGAGTCCCAAGAAGCAGGCAGG - Intronic
1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG + Intronic
1145888095 17:28396558-28396580 CAGTGTCTCCAGAACTGAGCAGG - Exonic
1145993535 17:29093092-29093114 CAGTGTCCCCATAAGGATGCTGG + Intronic
1146168290 17:30610295-30610317 CAATGTCACCCAAAGCATGCTGG - Intergenic
1146221262 17:31023785-31023807 CAATGTCACCCAAAGCATGCTGG - Intergenic
1147607427 17:41782165-41782187 CAGAGACACCAGAACCAGGCAGG + Intronic
1147938710 17:44029734-44029756 CAGTGGCAGCGGAAGCAAGGAGG - Intergenic
1148230677 17:45932257-45932279 AAATGGCGCCAGAAGCAAGCTGG + Intronic
1149537015 17:57440984-57441006 CAGTGTTGACAGGAGCAAGCTGG - Intronic
1150506650 17:65705606-65705628 CAATGACACCACAAGGAAGCAGG + Intronic
1152963939 18:97512-97534 CAGTGTCTCCAGCCGCCAGCAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156941617 18:42774060-42774082 CAGTGTCACCAGGAGCCAGTAGG + Intronic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1158153188 18:54394936-54394958 TAGTGTTTCCAGAACCAAGCCGG + Intergenic
1158403204 18:57139585-57139607 CTGTGTCACCAACAGCAGGCGGG + Intergenic
1159453842 18:68636728-68636750 AATTGTCACCAAAAGCAAGCAGG - Intergenic
1160653541 19:247087-247109 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1165956545 19:39504933-39504955 CAGTGTAGACAGAAGCGAGCAGG + Intronic
924958499 2:11790-11812 CAGTGTCCCCAGCTGCCAGCGGG - Intergenic
926669703 2:15564762-15564784 CAGTGTCACTACAAGCACGAGGG - Intergenic
929080728 2:38119588-38119610 CAGTATCACCAGGAGCCAGAAGG - Intergenic
932127353 2:69156081-69156103 CAGTGGCCCCATCAGCAAGCTGG - Intronic
932386348 2:71336684-71336706 CAATGTTACCCGGAGCAAGCTGG - Intronic
935089381 2:99880179-99880201 TAATATCACCTGAAGCAAGCAGG + Intronic
935564918 2:104595849-104595871 AGGTCTCACCAGAAGCCAGCAGG + Intergenic
936569367 2:113602006-113602028 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
937055984 2:118937228-118937250 CAGTGTTCCCAGAACCAAGCTGG + Intergenic
938366477 2:130738455-130738477 AAGGGTCACAAGAAGCCAGCTGG + Intergenic
938675823 2:133632952-133632974 CGGTGTGTCCAGATGCAAGCTGG - Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
941298523 2:163771807-163771829 CAGTGTCACACTAAGCAAACAGG - Intergenic
942519451 2:176788057-176788079 CAGTATAAACAGAAGCCAGCAGG - Intergenic
943416022 2:187605082-187605104 CAGTGTCACAGGAAACACGCAGG - Intergenic
947821301 2:233072964-233072986 CTGTGTCACCAGAACCTGGCAGG + Intronic
948018507 2:234710246-234710268 CAGCGTCAACACAGGCAAGCTGG - Intergenic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169417740 20:5432270-5432292 TAGTGCCACCAGCAGCCAGCAGG - Intergenic
1171128744 20:22628362-22628384 CAGTGGGACAAGGAGCAAGCAGG - Intergenic
1172567038 20:35938787-35938809 CACTGACACCAGGAGCAAGGAGG + Exonic
1173289087 20:41698702-41698724 CTGTGTCACCAGCAGAATGCAGG + Intergenic
1175468732 20:59210580-59210602 CAGGGTCACCATGAGCATGCAGG - Intronic
1176278048 20:64285699-64285721 CAGTGTCTCCAGCTGCCAGCAGG + Intronic
1176278092 20:64285942-64285964 CAGTGTCCCCAGCTGCCAGCAGG + Intronic
1176278106 20:64286004-64286026 CAGTGTCCCCAGCTGCCAGCAGG + Intronic
1177406823 21:20679856-20679878 CAGAGTCAACAAAAGCAAACCGG + Intergenic
1178990056 21:37345674-37345696 CAGTGTCATGAGAAGCAAAAAGG + Intergenic
1179439706 21:41384391-41384413 CAGTTTCATCAAAAGCAAGTTGG + Intronic
1179708077 21:43193994-43194016 CTGTGTCACCAGAACCCTGCTGG - Intergenic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1182015843 22:27038970-27038992 CAGTCACACCACAAGCAAGGGGG - Intergenic
1184744156 22:46446352-46446374 CAGGGTCACCCTAAGCAGGCAGG - Intronic
1184783137 22:46658967-46658989 CAGTGCCGCCAGCAGGAAGCAGG + Intronic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
950081814 3:10227975-10227997 GACTGTCACAAGAAACAAGCAGG - Intronic
953694576 3:45147326-45147348 CAGAGTCACCCGGAGCAACCTGG + Intergenic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
956061055 3:65348643-65348665 CGGTGTCACCAGAAAAAAGGAGG + Intergenic
956289628 3:67647820-67647842 CAGATTCCCCAGAAGTAAGCTGG + Intronic
956641995 3:71424185-71424207 TAGTCTCACCAGCAGCAAGAAGG + Intronic
957997659 3:87710748-87710770 CAGAGTCCCCAGCAGCAAGTAGG + Intergenic
959219614 3:103500124-103500146 CAGTGGCTGCAGAAACAAGCAGG + Intergenic
959770380 3:110088235-110088257 AATTGTAACCAGAAGAAAGCAGG - Intergenic
960302506 3:116021044-116021066 GAGTGTCACAAGGAGGAAGCAGG + Intronic
961315656 3:126033618-126033640 CAGAGTCATCAGCAGCAACCTGG - Exonic
961596493 3:128022119-128022141 CAAACTCACCAGAAGCCAGCCGG - Intergenic
961672864 3:128547638-128547660 CAGTCTCAACAGGAGCAAGGCGG + Intergenic
962241301 3:133753440-133753462 CAGAGTCAACTGAAGCCAGCAGG + Intronic
962401647 3:135065509-135065531 AATTGACACCAAAAGCAAGCAGG - Intronic
963913736 3:150838930-150838952 CAGTGCCACTAGAACAAAGCAGG - Intergenic
964624006 3:158741500-158741522 CAGTCTCACTAGATTCAAGCTGG - Intronic
968257653 3:197292002-197292024 CAGTCTCACCAGCAGCACACAGG - Intronic
968372962 4:11994-12016 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
968372975 4:12056-12078 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
968491686 4:893598-893620 CAGTGACGTCAGAAGCAAGAAGG + Intronic
969842365 4:9891922-9891944 CACTGTCACCTGAAGCTGGCAGG - Intronic
970754579 4:19409717-19409739 CAGTCTCAGGAGAAGAAAGCTGG - Intergenic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
973631640 4:52825650-52825672 CAGTGTCACCCGTATAAAGCAGG - Intergenic
976030669 4:80749760-80749782 CAGTGTCGCTAGAATAAAGCAGG - Intronic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
978523154 4:109637263-109637285 CAGTGTAACCATAAGGGAGCAGG + Intronic
978915925 4:114125858-114125880 CAGTGCCAGAAGAAGAAAGCAGG + Intergenic
979498928 4:121416956-121416978 AACTGACACCAAAAGCAAGCAGG - Intergenic
980852802 4:138403584-138403606 CTGTGTCACTACAAGCATGCAGG + Intergenic
980860876 4:138498173-138498195 CATGGACACCAAAAGCAAGCAGG - Intergenic
981367116 4:143916294-143916316 AAATGCAACCAGAAGCAAGCAGG + Intergenic
981376910 4:144026529-144026551 AAATGCAACCAGAAGCAAGCAGG + Intergenic
981387412 4:144147879-144147901 AAATGCAACCAGAAGCAAGCAGG + Intergenic
982690592 4:158543537-158543559 CAGTGTCTCCACAAACAAGATGG + Intronic
983277648 4:165637574-165637596 AAGGGACACCAAAAGCAAGCAGG + Intergenic
985462420 4:190120511-190120533 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
985462433 4:190120573-190120595 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
986855939 5:11868813-11868835 CAGAGTCTCCAGCAGCAAGAAGG + Intronic
988502127 5:31792269-31792291 CAAGGTCATCAGAAGCAGGCAGG + Intronic
989107922 5:37880740-37880762 CTGTGCCACCAGAACTAAGCAGG - Intergenic
990243744 5:53841068-53841090 AATGGACACCAGAAGCAAGCAGG + Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
992169703 5:74089560-74089582 AAGTGTCTCCAGAGGCCAGCAGG + Intergenic
993060881 5:83037589-83037611 CAGAGTCATTAGAAGGAAGCAGG + Intergenic
994521596 5:100844698-100844720 CACATTCACCAGAGGCAAGCTGG - Intronic
995856062 5:116593584-116593606 CAGGAACATCAGAAGCAAGCGGG - Intergenic
996313095 5:122129056-122129078 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
997440448 5:133905421-133905443 CATTGGCTCGAGAAGCAAGCTGG + Intergenic
998250871 5:140551342-140551364 CAGTGTCAGAAGAAGACAGCAGG - Intronic
999347687 5:150838949-150838971 CATTGACACCAGAAGCTTGCTGG - Intergenic
1000703880 5:164487554-164487576 CACTGTCAGGAGAAGCATGCGGG + Intergenic
1001259818 5:170218886-170218908 CAGAGCCACATGAAGCAAGCTGG + Intergenic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1002754798 6:148599-148621 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1002754847 6:148842-148864 CAGTGTCTCCAGCTGCCAGCAGG - Intergenic
1002807655 6:592553-592575 CAGGGTCACCAGACGCATGAAGG + Exonic
1003443837 6:6167108-6167130 CAGTGTCTCCAGAATAAAGTGGG - Intronic
1003452926 6:6253378-6253400 CAATGTTAGCAGAAGCAAGTAGG + Intronic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1011401684 6:86969703-86969725 CAGTGCCATCAGAAGCACGTGGG - Intronic
1011921966 6:92589172-92589194 CAGTGTCACACGGAGCAGGCTGG - Intergenic
1012206184 6:96463194-96463216 CACTGAAACCAGAAGTAAGCTGG + Intergenic
1015547991 6:134381706-134381728 AAGTGTCACTAGAAGCAACTTGG - Intergenic
1017767672 6:157620206-157620228 CAGTGTCCCCATCAGCAAGAAGG - Intronic
1017970725 6:159310432-159310454 CAGTGTAGCCAGAATAAAGCAGG + Intergenic
1019552282 7:1608999-1609021 CACTGTCCCCAGCAGCAAGGAGG - Intergenic
1020891242 7:13880440-13880462 CAGTGTCAACACAGGCAGGCAGG - Intergenic
1022923971 7:35042141-35042163 AGGAGTCAACAGAAGCAAGCTGG - Intergenic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023396435 7:39756019-39756041 CAGGTTCACCTGAAGCAAGTGGG - Intergenic
1023737583 7:43248498-43248520 CATTATAACCAAAAGCAAGCCGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024611962 7:51073836-51073858 CAGTGTCACCATTATCAAGATGG - Intronic
1024693171 7:51825203-51825225 CAGTGACATCAGGAGCATGCTGG - Intergenic
1024776166 7:52789053-52789075 CACTATCCCCAGAAGCAATCAGG + Intergenic
1024985589 7:55190939-55190961 CAGTGACCCCAGCAGCCAGCAGG + Intronic
1026378677 7:69777162-69777184 CAGTGTGGCCACAAGCAAACTGG + Intronic
1028825305 7:95265636-95265658 CATTTACACCAGAAGGAAGCTGG - Intronic
1029088741 7:98031890-98031912 AAGTGTCACCAGAGGCAGACTGG - Intergenic
1029822286 7:103157914-103157936 AGGAGTCAACAGAAGCAAGCTGG - Intergenic
1029874545 7:103735838-103735860 CAGCTCCACCAGAAGCAATCTGG + Intronic
1030668365 7:112307090-112307112 AATGGTCCCCAGAAGCAAGCTGG + Intronic
1031675977 7:124612428-124612450 AAATGACACCAAAAGCAAGCAGG + Intergenic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1034555888 7:151850129-151850151 CAGTGTCTGCAGAAAGAAGCGGG + Intronic
1035015548 7:155762740-155762762 CAGTGTCTCCAGGGGCAACCTGG - Intronic
1035513056 8:206823-206845 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1035513071 8:206884-206906 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1037336799 8:17800718-17800740 CCTTCTCAGCAGAAGCAAGCGGG - Intronic
1039400071 8:37261844-37261866 CAGTGGCATCAGAGCCAAGCTGG + Intergenic
1040745991 8:50643230-50643252 CAGTGTCAGCATAAGAAAGCAGG - Intronic
1040920235 8:52607971-52607993 CAGTGTCAACAGAAACAAAAGGG + Intergenic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1044143116 8:88679002-88679024 AAGTGTCACCAGAAGCTCACAGG + Intergenic
1044365581 8:91341678-91341700 GAGTGTGACCAGAAGCAACTGGG - Intronic
1044927046 8:97218335-97218357 CACTATCACGAGAAGCAAGGGGG + Intergenic
1045973998 8:108110792-108110814 CAGTGTCACAATAAGCATACAGG - Intergenic
1047160232 8:122369925-122369947 CAGTGTGACTAGAACAAAGCAGG - Intergenic
1047816971 8:128475284-128475306 CAGTGTTCCCAGAAGAAACCAGG + Intergenic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049883164 9:11523-11545 CAGTGTCCCCAGCTGCCAGCAGG - Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1053303757 9:36969608-36969630 CAGTCTCCCCAGAAGCAGACTGG + Intronic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1055800103 9:80025308-80025330 CAGTGTGGCCAGAATAAAGCAGG - Intergenic
1057141014 9:92726858-92726880 CAGTCTTACCTGAAGCCAGCAGG + Intronic
1057402960 9:94740786-94740808 CTGTGTAACCTTAAGCAAGCTGG + Intronic
1057544559 9:96007844-96007866 CACTGCCCCCAGAAGCCAGCAGG - Intronic
1058816797 9:108691822-108691844 CAGTGTAGCCACAAGGAAGCAGG + Intergenic
1059166308 9:112079486-112079508 TAGGGTCACCAGAAGCTGGCAGG - Intronic
1059415786 9:114161742-114161764 CAGTGACACCCGAAGCCACCTGG - Intronic
1059965064 9:119605740-119605762 CAGTGTCCCCACCACCAAGCTGG - Intergenic
1060015133 9:120080472-120080494 CACTGTCACCAGAATCAAGAAGG + Intergenic
1060852149 9:126886858-126886880 CAGAGTCACCAGAGTCAAACTGG - Intergenic
1060933688 9:127504179-127504201 CAGCGTCCGCAGAAGCAGGCAGG + Intergenic
1061279498 9:129589154-129589176 AAGTGTCACCAGAAGCCAGTGGG - Intergenic
1061935364 9:133854622-133854644 CGCTGTGACCAGAAGCAGGCTGG + Intronic
1062161428 9:135082427-135082449 AAGCATCACCAGAAGCAAGTGGG - Intronic
1062734175 9:138126274-138126296 CAGTGTCTCCAGCCGCCAGCAGG + Intergenic
1186047900 X:5556227-5556249 CTGTGTGGCTAGAAGCAAGCTGG - Intergenic
1186469095 X:9807363-9807385 GAGTGTCCCCAGGAGCAAGCAGG + Intronic
1186508395 X:10111823-10111845 CAGTGTCATCAGCAGCAAATGGG + Intronic
1187935887 X:24335362-24335384 TATTGGTACCAGAAGCAAGCAGG - Intergenic
1189603353 X:42650439-42650461 AATTGACACCAAAAGCAAGCAGG + Intergenic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1190588148 X:51967892-51967914 CAGTGATACCTGAAGCCAGCAGG + Intergenic
1190752831 X:53377037-53377059 CAGTGTTTCCAAGAGCAAGCTGG - Exonic
1191178522 X:57534059-57534081 CAGTGTCGCTAGAACAAAGCAGG + Intergenic
1191713133 X:64174156-64174178 CAGCATCAGCAGAAGCAAGTTGG - Intergenic
1193185729 X:78509808-78509830 AATGGTCACCATAAGCAAGCAGG + Intergenic
1195014671 X:100766441-100766463 GAGTCTCACCTGAAGCCAGCAGG + Intergenic
1198132770 X:133715116-133715138 CAGTGTGACTAGAATAAAGCAGG + Intronic
1200402649 X:156028626-156028648 CAGTGTCCCCAGCTGCCAGCAGG + Intergenic
1200831458 Y:7691038-7691060 CAGGGTTCCCACAAGCAAGCTGG - Intergenic