ID: 1125796345

View in Genome Browser
Species Human (GRCh38)
Location 15:42406741-42406763
Sequence CCTGCCAGGCACACACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125796345 Original CRISPR CCTGCCAGGCACACACTGGC AGG (reversed) Intronic
900012735 1:131081-131103 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
900042798 1:487068-487090 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
900064236 1:722059-722081 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
900132578 1:1093697-1093719 CAGCCCAGGCACCCACTGGCAGG - Intronic
901071287 1:6520021-6520043 CCTGCCAGGCAGAGAGGGGCTGG + Intronic
901162772 1:7192660-7192682 GATGCCCAGCACACACTGGCGGG - Intronic
901219333 1:7574274-7574296 CCTTCCAAGCAGACACTGCCAGG + Intronic
902121258 1:14167883-14167905 CCTGACAGGCACCCAGTGGCTGG - Intergenic
902378998 1:16043908-16043930 CCTGCCAGGGCCAGACAGGCAGG + Intronic
902705887 1:18204064-18204086 GCTGCCAGGCACATTCTGTCTGG - Intronic
903013764 1:20348677-20348699 CCTCCCAGGCACCAACTGCCAGG + Intronic
903920190 1:26794509-26794531 GCTGCCAGGAAGACATTGGCAGG - Exonic
904291809 1:29490964-29490986 CATGTCAGGCAAACAGTGGCAGG - Intergenic
905470152 1:38185725-38185747 CCTCCCTGGCAGACACTGGGAGG + Intergenic
906022846 1:42646362-42646384 TCTGCCAGGCACCCACTGTTTGG + Intronic
906701179 1:47859297-47859319 CCAGCCAGCCTCACACTGGCTGG + Intronic
911681383 1:100719785-100719807 CCTCCCAGGCACACACAGGTGGG + Exonic
912498525 1:110106721-110106743 CCTGCCTGTCATCCACTGGCTGG - Intergenic
917644581 1:177017691-177017713 CCTGCAGGGCACACTCTGTCTGG - Intronic
921492421 1:215794368-215794390 CGTGGCAGGCACACAATGCCAGG + Intronic
922261172 1:223947571-223947593 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
922287662 1:224183687-224183709 CCCGCCAGGCCCACGCCGGCCGG + Intronic
922629775 1:227094542-227094564 GCTGCCAGGAACACACTTCCAGG - Intronic
922735901 1:227978169-227978191 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
924342341 1:243049750-243049772 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1062859875 10:803045-803067 TCTGCCTGGCACTCACCGGCCGG + Intergenic
1064182767 10:13133773-13133795 CGTGCCAGGCACCTTCTGGCAGG - Intronic
1066734139 10:38455804-38455826 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1067667062 10:48287871-48287893 CCTGCCAAGCACTGTCTGGCTGG - Intergenic
1067734895 10:48842814-48842836 CCTGCCAGTCACACTCTTCCTGG + Intronic
1067834912 10:49632538-49632560 CCAGGCAAGCACTCACTGGCAGG + Intronic
1068919413 10:62466427-62466449 CAAGCCAGGCACAGAGTGGCAGG - Intronic
1069662273 10:70131736-70131758 CCTGCCCAGCCCACCCTGGCTGG + Intronic
1071088266 10:81889406-81889428 CATGACAGGCACTCTCTGGCAGG - Intronic
1071825664 10:89322885-89322907 CCTGCCTGGCAACCAGTGGCAGG - Intronic
1072249030 10:93567295-93567317 CCTGCCCGGCACACACAGAGGGG - Intronic
1073422388 10:103434718-103434740 AATGCCAGCCACACACAGGCTGG - Intronic
1075387175 10:122063315-122063337 TCTGCCCGACACACCCTGGCTGG - Intronic
1076193456 10:128498907-128498929 CGTGCCAGGCCCACACGTGCCGG - Intergenic
1076873667 10:133205586-133205608 CCTCCCGGGAACCCACTGGCTGG - Intronic
1077298653 11:1837515-1837537 CCAGCCGGACACACAGTGGCAGG - Exonic
1077473418 11:2775436-2775458 GCTGCCTGGCACAAACTGCCAGG + Intronic
1078056588 11:8014285-8014307 CCTGCCAAACACACAGTGGCAGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079107662 11:17582217-17582239 AGTGCTAGGCAAACACTGGCCGG + Intronic
1079225792 11:18603678-18603700 CCTCCCAGGCAAGGACTGGCAGG - Intergenic
1080987799 11:37491815-37491837 TCTGCCTGGAACACACTGGATGG + Intergenic
1082894557 11:58176296-58176318 CCTGCCATGCACCCACTGAGTGG - Intronic
1083821381 11:65173125-65173147 CCTGCCAAGCTCACACGGGAGGG - Intronic
1084438763 11:69158723-69158745 CTTCCCAGCCACACACTTGCAGG - Intergenic
1086156220 11:83669114-83669136 TCTGCCTGGCACACAGTAGCAGG - Intronic
1087195900 11:95304013-95304035 CTTGCCCAGCACACACTAGCTGG - Intergenic
1088825440 11:113490049-113490071 CTTGCCTGGCTCACATTGGCTGG + Intergenic
1089628822 11:119770683-119770705 CCTGCCATCACCACACTGGCTGG + Intergenic
1090466463 11:126939035-126939057 CCTGCCAGGCACACATAGTACGG + Intronic
1094068368 12:26385352-26385374 ATGACCAGGCACACACTGGCTGG + Intronic
1096094611 12:48925933-48925955 TCTGCCAGCCAGACACTGCCAGG - Intronic
1098091630 12:66908272-66908294 CCTGCCACCCACACTCTGCCTGG - Intergenic
1099304414 12:80937084-80937106 GCTGCCGGGCGCACAGTGGCGGG - Intronic
1100317712 12:93460821-93460843 CCTGACAGCCAAAAACTGGCTGG - Intergenic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102533069 12:113561241-113561263 CCTGGAAGGCACACGCCGGCCGG + Intergenic
1105038039 12:132940681-132940703 CCGGCCAGCCTCAGACTGGCAGG + Intronic
1106363994 13:29059976-29059998 CCTGCCTGGCTCCCAGTGGCAGG + Intronic
1107279205 13:38714159-38714181 CGTGCCATGCACATAGTGGCTGG + Intronic
1109044273 13:57388459-57388481 CCACCCAGCAACACACTGGCTGG - Intergenic
1109510564 13:63367292-63367314 CAAGCCAGGCACAGCCTGGCAGG - Intergenic
1111791660 13:92864331-92864353 CCTGCAAGCCAGACAATGGCAGG - Intronic
1113798818 13:113075886-113075908 CTGTCCAGGCACACACTGCCGGG - Intronic
1113951231 13:114072138-114072160 CCTGCCTGGCACACTCTCCCTGG + Intronic
1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114114985 14:19511672-19511694 CCATCCAGGAAAACACTGGCTGG - Intergenic
1114116676 14:19629435-19629457 CCATCCAGGAAAACACTGGCTGG - Intergenic
1119168056 14:72512408-72512430 CCTGCCAGGGACACACTCCTTGG - Intronic
1119390310 14:74287135-74287157 CCTGCCAGGCACAGCTTGGTGGG + Intronic
1120927686 14:89814282-89814304 CCTGCCAGCAACACACGGTCTGG + Intronic
1122402606 14:101476225-101476247 CGTGCCCGGCACACCCTGCCAGG + Intergenic
1122765226 14:104064524-104064546 CCTGCCAGGCACTGACTGGCAGG + Intergenic
1124623803 15:31296863-31296885 CCTTTCAGGTACACATTGGCGGG + Intergenic
1124707250 15:31976226-31976248 CATGCCAGGCACAAAATGCCAGG - Intergenic
1125796345 15:42406741-42406763 CCTGCCAGGCACACACTGGCAGG - Intronic
1125827488 15:42688777-42688799 CCTCTGAGGCACACACTGCCTGG + Exonic
1128239856 15:66094424-66094446 CCAGCCAGGCTCGCAGTGGCAGG + Exonic
1129297947 15:74610116-74610138 CCTGCCATGCACCCACTTGGGGG + Intronic
1129794321 15:78364390-78364412 CCTTTCAGACACACGCTGGCAGG + Intergenic
1131337082 15:91559484-91559506 CCTGCCTTCCACACACTGACAGG + Intergenic
1131868932 15:96741789-96741811 CCTGCCTGGCCCTGACTGGCTGG + Intergenic
1132622437 16:874257-874279 CCAGCCCCGCACACACAGGCCGG - Intronic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1132661218 16:1062349-1062371 CCTTCCTGGCACCCACTGGCTGG + Intergenic
1133119249 16:3596170-3596192 CCAGCCAGGCCCCCACTGCCGGG + Exonic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1135777636 16:25270917-25270939 GCTGCCAGGCACACAACAGCTGG + Intergenic
1136995017 16:35183191-35183213 CCTGTCACGCACACACTGAAGGG + Intergenic
1137609943 16:49811446-49811468 CCTGCTAAGCACACTCTGGGTGG - Intronic
1138780963 16:59785346-59785368 CTTGCCAGGAACACAGTGGGTGG - Intergenic
1139650952 16:68361796-68361818 CCTGCCAGGCCCACAGGGGCGGG - Intronic
1139852813 16:69961171-69961193 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1139881784 16:70184079-70184101 CCTGCAAGGCAACCAGTGGCTGG - Intronic
1140152881 16:72389853-72389875 CATGCCAGATACAGACTGGCAGG + Intergenic
1140370725 16:74411427-74411449 CCTGCAAGGCAACCAGTGGCTGG + Intronic
1141542259 16:84734847-84734869 CCTGCCAGGGCCACAGGGGCAGG - Intronic
1141887986 16:86905958-86905980 TCTGCCTAGCAGACACTGGCTGG - Intergenic
1141997709 16:87645799-87645821 CCTGCCAGCCACAGCTTGGCGGG - Intronic
1142427622 16:90009044-90009066 CCTGCAAAGCCCACACCGGCAGG + Intronic
1142451604 16:90175837-90175859 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1144103180 17:11962044-11962066 CCTGTCAGCCACACAGTGGAGGG - Exonic
1144770623 17:17757480-17757502 CAGGCAAGGCACACACTGGCAGG - Intronic
1144854715 17:18261425-18261447 CCTGGCACCCACACTCTGGCAGG + Intronic
1145061556 17:19737407-19737429 CCTGCCAGGCCCAGGCTGGGAGG + Intergenic
1146400161 17:32495346-32495368 CCTGCCTGTCACACCCCGGCTGG + Intronic
1147935482 17:44008198-44008220 CTTGCCAGGCGCACACAGGAAGG - Intronic
1148061757 17:44841578-44841600 CCTGCCTGCCCCAGACTGGCTGG + Intergenic
1148700151 17:49582230-49582252 CTTGCCATGCACACACTCACAGG + Intronic
1148736916 17:49870079-49870101 CCTGCCTGCCACCCACTGTCTGG - Intergenic
1150345824 17:64403947-64403969 CAAGCCAGGCAGACACAGGCAGG - Intronic
1151367332 17:73626112-73626134 CCTGCCAGGCTCCCGCTGCCTGG - Intronic
1152605653 17:81288358-81288380 CATCCCAGCCGCACACTGGCTGG + Intronic
1152703741 17:81832693-81832715 CCTTCTAGGCACTCACTGGGCGG - Intronic
1203165391 17_GL000205v2_random:88644-88666 CCAGCAAGGCGCACACTGCCCGG + Intergenic
1156557096 18:38079731-38079753 CATGCCAGACACACACTCTCTGG + Intergenic
1157485019 18:48080699-48080721 CCAGCCAAGCTCACAGTGGCTGG - Intronic
1158513682 18:58113564-58113586 CCAGGCAGGGACACTCTGGCAGG + Intronic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1160080797 18:75725407-75725429 CCTCCCAGGCCCGCTCTGGCGGG - Intergenic
1160239206 18:77111106-77111128 CCTCCCAGGCAAACATTGCCAGG - Intronic
1160645877 19:193211-193233 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1160940597 19:1618856-1618878 GCTGCCAGGCACACAGCGTCTGG + Intronic
1161530352 19:4785306-4785328 CCAGCCAGGCACACGCTGCGGGG - Intergenic
1162736806 19:12751597-12751619 CCTCCCAGTCGCTCACTGGCAGG - Intergenic
1162743161 19:12784314-12784336 CCAGCCAGGGACACACAGACAGG + Intronic
1163106143 19:15124102-15124124 CGTGCCAGGCACATGGTGGCTGG - Intronic
1163287523 19:16357824-16357846 CCTGGCAGTGACACAATGGCGGG - Intronic
1163494742 19:17639751-17639773 CCTCCCATGCACACACCTGCTGG + Intronic
1164137456 19:22427649-22427671 CCTGGCAGCCACACACAGGGAGG - Intronic
1164160751 19:22624047-22624069 CCTGGCAGCCACACACAGGGAGG + Intergenic
1164479084 19:28597795-28597817 CTTGCCAGCCACACACTGTGAGG - Intergenic
1164862243 19:31570918-31570940 GCCGCCTGGCACACAGTGGCTGG - Intergenic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1165067127 19:33235883-33235905 CCTGCCAGGCCCATCTTGGCCGG + Intergenic
1165447481 19:35864549-35864571 CCTGCCTGGCCTCCACTGGCTGG + Intronic
1165830700 19:38728923-38728945 GCAGCCAGGCCCACACTGGTGGG - Intronic
1168245197 19:55109660-55109682 CCTGGCAGCCACTCACAGGCAGG - Intronic
1168427901 19:56253582-56253604 CTGGCAAGACACACACTGGCTGG + Intronic
925884429 2:8382261-8382283 CCTGCCACACACACAAAGGCTGG + Intergenic
926425125 2:12732959-12732981 CCTGCCAGGCCCACTTTGTCTGG + Intronic
927639952 2:24840031-24840053 CCTGCCAGGTACACACAGAAAGG + Exonic
927702754 2:25278191-25278213 CCTGTCAGGGCCACACTGGAAGG - Intronic
929668361 2:43851304-43851326 CCTGTCAGGCCACCACTGGCTGG + Intronic
931021381 2:58047730-58047752 CCTGATAGGCACACAAGGGCTGG - Intronic
932594562 2:73086079-73086101 CCTGCAAGGCACACAAGGCCAGG + Intronic
934477617 2:94603777-94603799 ACTGCCAGGAACACACGCGCTGG + Exonic
936029150 2:109057844-109057866 CCAGCCAGGCAGACCCAGGCAGG - Intergenic
937271788 2:120657518-120657540 CTTGCCAGGCCCACACTAGCAGG - Intergenic
938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG + Intronic
945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG + Intergenic
946578832 2:221104673-221104695 CCTGCCACGTCAACACTGGCCGG + Intergenic
946984347 2:225255551-225255573 CTTGCAAGGCACAAACTGGAAGG + Intergenic
947713410 2:232328448-232328470 CCTGGCAGGCCCACCCTGGGTGG + Intronic
948690623 2:239701200-239701222 ACTGCCAGGCACTCACGGGGAGG - Intergenic
949047049 2:241877032-241877054 CCTGCCAGGCCACCTCTGGCTGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172744323 20:37194805-37194827 CTGCCCAGGCACACACTGGCTGG - Intronic
1172807422 20:37622517-37622539 CTTGCCTGGCACTCTCTGGCTGG - Intergenic
1174367380 20:50064708-50064730 CCTCCCAGGCACACACAGAGGGG + Intergenic
1176154385 20:63610911-63610933 CCTGCTAAGCACACCCAGGCAGG + Intronic
1176181386 20:63751458-63751480 CCGGCCAGGCAAACACGGGGAGG + Intronic
1176257735 20:64160886-64160908 CCTGCCAGGCAGATCCAGGCAGG - Intronic
1176279629 20:64293005-64293027 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1176406361 21:6370435-6370457 CCAGCAAGGCGCACACTGCCCGG - Intergenic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1180148229 21:45933877-45933899 CCTGCCAGCCACACCCTCCCTGG - Intronic
1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG + Intergenic
1180556520 22:16582443-16582465 CCTGCTAGGGACAGTCTGGCAGG + Intergenic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1183381965 22:37494696-37494718 CCTGCCACGCACAGCCTGACAGG + Intronic
1183505599 22:38207055-38207077 CCTGCCAGGGCCACACAGGGAGG + Intronic
1183738687 22:39658054-39658076 CCTGCCAGGGTCACACAGCCAGG + Intronic
1184192998 22:42907553-42907575 CCTGCAAGGCTGACACAGGCAGG + Intronic
1184331711 22:43831977-43831999 CCTCCCAGCCACACAGTGACGGG + Intronic
1184521873 22:44999427-44999449 CCGGCCAGCCACACACTCCCCGG + Intronic
1184746735 22:46460609-46460631 CCTGAGAGGCAAACACGGGCTGG - Intronic
950006829 3:9696909-9696931 CCTCCCCGACCCACACTGGCTGG + Intronic
950544111 3:13628823-13628845 CCTCCCAGGGCCACACTGGGAGG - Intronic
951580739 3:24160116-24160138 ACTGCCAGCCACACCCTGGTGGG - Intronic
952925355 3:38315989-38316011 CCTGCCTTGCACTCACTGCCTGG + Intronic
954413719 3:50382721-50382743 CCTGCCAGGCAGACTCTCTCAGG - Intronic
954576114 3:51677280-51677302 CCTAACACCCACACACTGGCAGG - Intronic
955393080 3:58535322-58535344 CCTACCATGCACACAGTGCCTGG - Intronic
961377826 3:126478548-126478570 CCTGCCATCCAGAAACTGGCCGG + Intergenic
961456631 3:127027841-127027863 CTTGCCAGGAACACCATGGCTGG + Intronic
962357674 3:134708872-134708894 CCTTCCAGACACACACTCACAGG - Intronic
962373346 3:134839630-134839652 CCTGCCAGGCTGACTCTGACTGG + Intronic
962890946 3:139672571-139672593 CCTGCCTTGCACAGACTGGTGGG - Intronic
966370272 3:179244431-179244453 CCTGCTAGGGACAGTCTGGCAGG + Intronic
968039105 3:195573632-195573654 CCTGCGGGGCACAAACTGACAGG - Intronic
968371804 3:198226315-198226337 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
968443026 4:634081-634103 CCTCCCAGGCACACACTCCCAGG - Intronic
968522491 4:1040231-1040253 CCTGGCAGGGCCTCACTGGCAGG + Intergenic
968817990 4:2831630-2831652 CCTCACAGGCTGACACTGGCGGG + Exonic
968920603 4:3520446-3520468 CCTACCAGGGACACGCCGGCTGG + Intronic
969086786 4:4662590-4662612 AGTGAAAGGCACACACTGGCAGG - Intergenic
969140731 4:5069280-5069302 CCTCCCAGGTTCACAATGGCAGG + Intronic
969696788 4:8739532-8739554 CCCGCCAGGGCCACACTGGAAGG - Intergenic
970450194 4:16158555-16158577 CGTTCCTGGCACACACAGGCAGG - Intergenic
972447339 4:39157763-39157785 CCAGCCTGGCACTCACTGGTAGG - Intergenic
973218471 4:47698404-47698426 CCTGCCGGGCAGACTCTTGCCGG - Intronic
979260492 4:118638793-118638815 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
982099234 4:151952270-151952292 TGTGCCAGCCACACACAGGCTGG - Intergenic
984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG + Intergenic
985065688 4:186118816-186118838 CCAGCCAAGCACCCACTGCCTGG + Intronic
988509821 5:31855441-31855463 CCTGCCCGTCACACACAGCCGGG - Intronic
989305276 5:39947978-39948000 ACTTCCAGTCACACACTGGAGGG - Intergenic
991575847 5:68102623-68102645 ACTTCGAGGCACACCCTGGCTGG + Intergenic
992140934 5:73796300-73796322 CCTGGAAGGCACACATGGGCAGG + Intronic
995099244 5:108278595-108278617 CAGGCCAGGCACAAACTGCCAGG + Intronic
995726496 5:115186381-115186403 ACTGCCAGGCACACAGTAGGTGG - Intergenic
996797866 5:127369958-127369980 CCAGCCAGGCTCACACTGACAGG - Exonic
998390068 5:141781640-141781662 CCTGCCTGCCACTCACTTGCTGG - Intergenic
999769029 5:154761239-154761261 CCTGGCAGGCACTCACTTCCGGG - Intronic
1001421774 5:171593036-171593058 CCTGCCAAGCACACATTGCAAGG - Intergenic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1002134806 5:177100912-177100934 CCTGGCAGGCACACGCTTCCTGG + Intergenic
1002560909 5:180081421-180081443 CCTGCCAGGTGAACGCTGGCTGG + Intergenic
1002731045 5:181331861-181331883 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1002753489 6:142243-142265 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1002896166 6:1381857-1381879 CCTGCGGGTCACACACCGGCCGG + Intergenic
1002955646 6:1860838-1860860 CATGGCAGGCACACACTGATGGG + Intronic
1003963319 6:11229408-11229430 CCTGGCAGGCACAAACGGGGTGG + Intronic
1005824979 6:29627353-29627375 CCTGCCAGTCACACAAGGGAGGG + Intronic
1006572153 6:35014620-35014642 CCAGCCTGGCTCACACTGCCTGG - Intronic
1011723051 6:90178839-90178861 TCTCCCAGGAACACACTGGGTGG - Intronic
1018371164 6:163169798-163169820 CCAGCCAGCCACAAACTGGGTGG + Intronic
1022113219 7:27243813-27243835 CCTGCCAGCCACAAACTGCCCGG - Intronic
1023335166 7:39161498-39161520 CCTGCCAGGCAGATCCAGGCTGG + Intronic
1023366870 7:39473479-39473501 ACTGGCAGGCTCATACTGGCTGG + Intronic
1024076188 7:45819023-45819045 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1024576243 7:50767173-50767195 CCTCCCAGGTACCCACTGCCTGG + Intronic
1025176594 7:56805310-56805332 CCTGCCAGGAACCCCCTGCCCGG + Intergenic
1026852671 7:73734976-73734998 CCAGCAAGGCACTCCCTGGCAGG - Intergenic
1028405523 7:90469743-90469765 CCTGCCAGGTTCCCAGTGGCTGG + Intronic
1029588804 7:101493324-101493346 CCTGCCAGGCAAACACTGAAGGG - Intronic
1031985939 7:128164763-128164785 CCTGCCCAGCACACACATGCAGG - Intergenic
1032434781 7:131890884-131890906 ACTGCCAGGCCCATACTTGCAGG + Intergenic
1032457001 7:132080709-132080731 CTTGCCAGGCACCCTCTGGCAGG + Intergenic
1032736542 7:134697534-134697556 CCAGGCAGGCACACCCTGGTTGG + Intergenic
1033282649 7:140017135-140017157 CCTGCAAAGCAAACACGGGCAGG + Intronic
1034273737 7:149815243-149815265 CCTGGCTGGCACACACTCCCAGG - Intergenic
1034276988 7:149828193-149828215 CCGGCTAGGCACTCACAGGCTGG + Intergenic
1035232742 7:157476266-157476288 CCTGCCAGGCACTCAGTGGCTGG - Intergenic
1035751361 8:1998954-1998976 CCAGCCATGCCCACACTGACAGG - Intronic
1035909937 8:3555099-3555121 CGTGACAGGCAAACCCTGGCAGG + Intronic
1037415128 8:18641343-18641365 ACTGCCTAGCACACACTGCCTGG - Intronic
1038927753 8:32158945-32158967 CCTGCCAGACAGACTCTGGTGGG - Intronic
1040836462 8:51736625-51736647 GCTGCCAGGGACACACTTTCAGG - Intronic
1042732588 8:71953946-71953968 CCTGGCAGGAACACAGTGGTAGG - Intronic
1044408712 8:91860851-91860873 CCTGCTGGCCTCACACTGGCTGG + Intergenic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1048980347 8:139700226-139700248 GCTGCCAGGCACAGTGTGGCCGG - Intronic
1048985761 8:139733896-139733918 CCTGCCTGGCTCACACGGTCAGG + Intronic
1049780985 8:144428746-144428768 CCTGCCAGGCAGCCACGGGGAGG + Intergenic
1053930434 9:43110641-43110663 ACTGCCAGGAACACACGCGCTGG - Intergenic
1057304474 9:93904295-93904317 CCTGCCAGGCACACTCCTGGCGG - Intergenic
1057312555 9:93951353-93951375 CCTGCCAGCGACTCTCTGGCTGG + Intergenic
1057461691 9:95268834-95268856 GCTGCCAGGCACACACCTGGAGG - Intronic
1061121701 9:128647277-128647299 CTTGCTAGTCACACACTGCCTGG - Intronic
1061570148 9:131473093-131473115 ACTACCAGGAACAGACTGGCGGG - Intronic
1061588373 9:131583056-131583078 CTTCCCAGGCACACACTGAGTGG + Intronic
1062097800 9:134711930-134711952 CCTGTCAGGCACTCACAGACAGG - Intronic
1062118592 9:134822144-134822166 CCTCCCAGATACACACCGGCAGG - Exonic
1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG + Exonic
1062590549 9:137272659-137272681 CTTGGCAAGCACACACGGGCTGG - Intronic
1062637647 9:137500055-137500077 TCTGCCAGGCAGCCACAGGCGGG + Intronic
1062755450 9:138284368-138284390 CCTGCCAGGAACCCCCTGCCCGG - Intergenic
1185469179 X:372463-372485 CCCGCCACGCACACCCTGTCTGG + Intronic
1185509548 X:652784-652806 CCGGCAAGACACACACAGGCTGG - Intronic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1186191704 X:7073108-7073130 CCTGCCTGGCACACAGTGGGCGG + Intronic
1187319254 X:18225901-18225923 CATGCCAGGACCACTCTGGCAGG - Intergenic
1195667932 X:107447693-107447715 TCTGCCAGGGACAGTCTGGCTGG + Intergenic
1200121238 X:153791804-153791826 CCGGCCAGGGACACACAGACAGG - Intronic
1202124775 Y:21557827-21557849 CCAGCCAGCCACAGACTCGCTGG - Intergenic
1202154233 Y:21871553-21871575 CCAGCCAGCCACAGACTCGCTGG + Intergenic