ID: 1125800140

View in Genome Browser
Species Human (GRCh38)
Location 15:42438498-42438520
Sequence ATAGAATAGGAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 487}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125800140_1125800148 23 Left 1125800140 15:42438498-42438520 CCCTCCCCATTCTCCTATTCTAT 0: 1
1: 0
2: 6
3: 40
4: 487
Right 1125800148 15:42438544-42438566 TCCTGGCTTTAATATTTACAAGG 0: 1
1: 0
2: 0
3: 19
4: 265
1125800140_1125800146 -6 Left 1125800140 15:42438498-42438520 CCCTCCCCATTCTCCTATTCTAT 0: 1
1: 0
2: 6
3: 40
4: 487
Right 1125800146 15:42438515-42438537 TTCTATAAATATATTTAAGTAGG 0: 1
1: 0
2: 10
3: 81
4: 864
1125800140_1125800147 6 Left 1125800140 15:42438498-42438520 CCCTCCCCATTCTCCTATTCTAT 0: 1
1: 0
2: 6
3: 40
4: 487
Right 1125800147 15:42438527-42438549 ATTTAAGTAGGTTTAAATCCTGG 0: 1
1: 0
2: 1
3: 33
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125800140 Original CRISPR ATAGAATAGGAGAATGGGGA GGG (reversed) Intronic
901243603 1:7710719-7710741 ATAGAGGAGGAGAGTGGGGTGGG - Intronic
902429266 1:16350454-16350476 ATAGAAAAGGAGGCTGGGCACGG + Intronic
902646002 1:17798336-17798358 TTAGAATAGGTGACTGGGGAGGG + Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
903791779 1:25898147-25898169 TTAGAATAAAAAAATGGGGAGGG + Intronic
903818845 1:26085474-26085496 ATAGAAGGGGAGAACGGGGAGGG - Intergenic
904138473 1:28332586-28332608 AGAGAATAGGAGAAGGGGTGTGG + Intronic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
904971464 1:34422300-34422322 TTAAAATGGGAGCATGGGGAAGG + Intergenic
905026094 1:34850792-34850814 ACAGATCAGGAGAATTGGGAGGG - Intronic
905338082 1:37259081-37259103 ACAGAGTAGGAAAATGGAGAAGG + Intergenic
906042382 1:42798004-42798026 AAAGAATGGGAGGGTGGGGACGG + Intergenic
906225652 1:44119128-44119150 AAGGAATGGGAGATTGGGGAGGG + Intronic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
907398013 1:54205725-54205747 ATAGAATATGAGCATTGTGAGGG - Intronic
907644397 1:56227453-56227475 ACAAAGTAGGAAAATGGGGAAGG + Intergenic
908114748 1:60929665-60929687 AGACTATAGGAGAATAGGGAAGG + Intronic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
908909397 1:69055534-69055556 ACACACTAGGAGGATGGGGATGG + Intergenic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
909762518 1:79309562-79309584 ATAGAAAAGCAGCATGGTGATGG + Intergenic
910928836 1:92422617-92422639 ATGGAATATGAGGATTGGGAGGG - Intergenic
911218345 1:95219973-95219995 GTACAAAAGGAGAGTGGGGAAGG - Intronic
911959163 1:104277585-104277607 ATAGAAAAGGAAAATGCAGATGG + Intergenic
912303371 1:108539748-108539770 ATAGAGTAAGAGTATGGGCAGGG - Intergenic
912383541 1:109260266-109260288 CTAGAATCTGGGAATGGGGAGGG + Intronic
913057518 1:115176010-115176032 TGGGAATAGGAGAATGGGGTGGG + Intergenic
913478698 1:119263876-119263898 ATAGAAGGGGAGGCTGGGGAGGG - Intergenic
913583590 1:120251028-120251050 GTAGAATGGGAGAATGGGAGTGG - Intergenic
913624586 1:120647292-120647314 GTAGAATGGGAGAATGGGAGTGG + Intergenic
913707953 1:121446831-121446853 GGAGAAAAGGGGAATGGGGAGGG + Intergenic
913718932 1:121571310-121571332 ATAGAAAAGGAGACTGAGGTAGG - Intergenic
914565578 1:148862864-148862886 GTAGAATGGGAGAATGGGAGTGG - Intronic
914607247 1:149267388-149267410 GTAGAATGGGAGAATGGGAGTGG + Intergenic
914676569 1:149910944-149910966 ATAGGAGAAGACAATGGGGATGG + Exonic
915062941 1:153201667-153201689 ATAAAAGAGGAGAATGGGTTGGG - Intergenic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
917065449 1:171087723-171087745 ATAGAATATGAGAAATGGAATGG + Intergenic
917180230 1:172288286-172288308 ATAGATTAGGTGAAGGGAGAAGG + Intronic
917497238 1:175551835-175551857 ATATATTGGAAGAATGGGGAGGG + Intronic
918063175 1:181079743-181079765 TTAGAATAGGAGGAGGGGGAAGG + Intergenic
918169368 1:181981640-181981662 ATAGGATAGAAAAATGAGGAGGG + Intergenic
918251022 1:182703414-182703436 ATAGAATTGGAGCTTGTGGAGGG + Intergenic
919169580 1:193937292-193937314 ATAGAAAGGGAAAGTGGGGATGG - Intergenic
922209497 1:223476717-223476739 AGAGAAGAGGAGAAGGAGGAGGG + Intergenic
922621476 1:226991944-226991966 AGGGAAGAGGAGGATGGGGAGGG + Exonic
922665764 1:227467169-227467191 ATAGATAAGGAGAATGGGATGGG - Intergenic
922828781 1:228539930-228539952 TTAGAATACCGGAATGGGGAAGG + Intergenic
923902048 1:238336582-238336604 ATGGCATTGGAGAAGGGGGATGG + Intergenic
924319256 1:242830836-242830858 ATAGCATAGAATAATGAGGAAGG + Intergenic
924676354 1:246182276-246182298 AGGTAATAGGAGAAAGGGGAAGG - Intronic
1063286765 10:4697103-4697125 ATAGAAATGGAGAATGCAGAAGG + Intergenic
1064666254 10:17655068-17655090 AGAGAAGAGGAGAATCAGGAAGG - Intronic
1064801231 10:19075241-19075263 AGAGGATAGGAAATTGGGGACGG - Intronic
1065293951 10:24257436-24257458 AAAGAAAATGAGAAAGGGGAAGG - Intronic
1065334575 10:24643478-24643500 ATAGTTTAGAAGAATGGAGAAGG - Intronic
1065588397 10:27241559-27241581 ATTTAATAGGAGACTGGGCATGG + Intronic
1065629586 10:27664427-27664449 AGAGAAGAGGAGAAGAGGGAGGG + Intergenic
1067251778 10:44592865-44592887 CTAGAATCGCATAATGGGGAAGG - Intergenic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1069189629 10:65469788-65469810 ATAGAATATGACAAAGGTGATGG - Intergenic
1070490977 10:76976267-76976289 AGCTAATAGGAAAATGGGGAGGG + Intronic
1070541162 10:77416308-77416330 ACACAATAGGGGAAAGGGGAAGG + Intronic
1070590439 10:77796888-77796910 AGAGCAGAGGAGAATGGAGATGG - Intronic
1071343791 10:84672270-84672292 ATTGAATTGAAGAATGGGAAAGG - Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1073674424 10:105629457-105629479 ATAGAATAGGGAAATGGGTCAGG + Intergenic
1073771814 10:106743210-106743232 AGAGGATAGGAGAATGAGAAGGG + Intronic
1074304348 10:112262961-112262983 AGAGAATTGCAGAGTGGGGAGGG - Intergenic
1075018096 10:118925882-118925904 CTAGAGTAGGATAATAGGGAGGG - Intergenic
1075282452 10:121151649-121151671 AAACAAGGGGAGAATGGGGAGGG - Intergenic
1075808133 10:125204786-125204808 AGACAGTAGGAGAGTGGGGAGGG + Intergenic
1076277507 10:129215361-129215383 GAAGAATGGGAGAATGGAGAGGG + Intergenic
1076778123 10:132709358-132709380 GTAGGAGAGGAGAATGGGGAGGG + Intronic
1076927711 10:133501474-133501496 AGGGCATAGGATAATGGGGAAGG - Intergenic
1077328367 11:1973319-1973341 GGAGACTAGGAGAATGGAGACGG + Intronic
1078427558 11:11264274-11264296 ATAGAAGAGGATAAAAGGGAAGG + Intergenic
1078833696 11:15003987-15004009 ATAAAAAATGAGAATGGGAATGG - Intronic
1079638622 11:22776455-22776477 ATAGAACAGGATAATATGGAAGG + Intronic
1079732020 11:23945211-23945233 CTAGAATAAGAGAAGGGAGAGGG - Intergenic
1080542496 11:33281410-33281432 ATAGAAGAGGAAAAAGTGGATGG - Intronic
1080958149 11:37125589-37125611 TAAGAATAGGAGAGTGGTGAAGG + Intergenic
1081005811 11:37737275-37737297 ATAGAATAGAAGTTTGGAGATGG + Intergenic
1081236799 11:40656265-40656287 CAAGAATGGGAGAATAGGGAAGG - Intronic
1081503696 11:43693030-43693052 ATAGAATAGCAGAACTGGAAGGG + Intronic
1083597475 11:63925274-63925296 ACAAAAAAGGGGAATGGGGATGG - Intergenic
1083672591 11:64307330-64307352 AAGGAAGAGGAGGATGGGGAGGG + Exonic
1083743395 11:64722734-64722756 AGAGCTGAGGAGAATGGGGAGGG - Intronic
1085145443 11:74191781-74191803 ATAGAATGCGAGAGTGAGGAAGG + Intronic
1087287223 11:96278014-96278036 ACAGAATTGGAGACTGGGGATGG - Intronic
1088447401 11:109946790-109946812 ATAAAATAGGAGCCTGGGGAGGG + Intergenic
1089110691 11:116053463-116053485 AGAGAAAAAGAGAGTGGGGATGG - Intergenic
1089328431 11:117673511-117673533 AGAGGATGGGAAAATGGGGATGG - Intronic
1089501133 11:118931904-118931926 ATAGAATAGGAGGCTGGGTGTGG + Intronic
1089926699 11:122266043-122266065 ATAGAATGTTAGAATGGGAAAGG - Intergenic
1090163258 11:124517695-124517717 TTAGTATAGGATAATAGGGATGG + Intergenic
1090499795 11:127250360-127250382 TTAGAAATGGAGAGTGGGGAAGG + Intergenic
1090640618 11:128726298-128726320 ATAGAGTAGGAGTCTGGGGCTGG - Intronic
1090671993 11:128954617-128954639 CTAGCATAGGAAAATGGGGATGG + Intergenic
1091182079 11:133614426-133614448 AAAGAAAAGAAGAATAGGGAAGG + Intergenic
1202811345 11_KI270721v1_random:28498-28520 GGAGACTAGGAGAATGGAGACGG + Intergenic
1091851681 12:3704606-3704628 ATAGAAAAGAAGAATGGGTCTGG + Intronic
1092931521 12:13320244-13320266 ATAGAAGGTGAGAATGGGGAAGG + Intergenic
1093106945 12:15098245-15098267 GAAGAATACAAGAATGGGGAGGG - Intergenic
1093893262 12:24548638-24548660 ATAGGTTAGTGGAATGGGGATGG + Intergenic
1095197048 12:39332332-39332354 ATAGTCAAGGAGAATGGAGAGGG - Exonic
1096008575 12:48193158-48193180 ATTGAATAGGAAAATGGGGGTGG + Intergenic
1096841622 12:54383402-54383424 AGAGAAAGGGAGAATGGGGGAGG - Intronic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097191592 12:57221986-57222008 AGAGACTGAGAGAATGGGGAGGG + Intronic
1099791848 12:87345650-87345672 AAATAATAGGAGAAAGTGGAGGG + Intergenic
1099935631 12:89121661-89121683 ATAGAATCTGAGAAGTGGGAAGG + Intergenic
1100216160 12:92450960-92450982 GCAAACTAGGAGAATGGGGATGG - Intergenic
1100233274 12:92631966-92631988 ATAGAATAGGAGCATGAGCTTGG + Intergenic
1100262983 12:92950281-92950303 AAAGAAAAGAAGAATGGGTACGG + Intergenic
1100504239 12:95204395-95204417 TTAGCAAAGGAGAACGGGGAGGG + Intronic
1101316982 12:103638294-103638316 ATTGAAAGGGAGAATTGGGATGG - Intronic
1101599331 12:106195397-106195419 TTAGAATAGGAGAGTGGGGTTGG - Intergenic
1101627187 12:106456789-106456811 ATAGAATATTAGAATTGGAAAGG - Intronic
1101793468 12:107951823-107951845 AGAGAATAAGAGAAGTGGGATGG + Intergenic
1102802222 12:115745764-115745786 ATAGAATATGACAAAGGTGATGG - Intergenic
1103352908 12:120297773-120297795 GTAAAATTGGTGAATGGGGAAGG + Intergenic
1104111201 12:125706394-125706416 ATACAATAGCTGAATGCGGAAGG + Intergenic
1105344574 13:19561086-19561108 AAGGAAGAGGAGGATGGGGAGGG - Intergenic
1106871496 13:34026617-34026639 AGAAAATAGGAGCAAGGGGAAGG + Intergenic
1107387877 13:39932069-39932091 ATAGAATAATAAAATGGAGACGG + Intergenic
1107455540 13:40551146-40551168 ATAGAATAGGAGGTTGAGGGAGG - Intergenic
1107645284 13:42488294-42488316 ATAGGAGTGGAGAATGGGGCGGG + Intergenic
1107923977 13:45240210-45240232 TTAGGATGGGAGCATGGGGATGG + Intronic
1108021635 13:46133721-46133743 AGAAACTAGGTGAATGGGGAGGG + Intronic
1108068612 13:46604415-46604437 TTAGAATAGGATGATGGGGGTGG + Intronic
1108215427 13:48179139-48179161 TTAGAGTAGGTGAATGGAGAGGG + Intergenic
1108424883 13:50289477-50289499 CTTGAATTGGAGGATGGGGAGGG + Intronic
1109452925 13:62541927-62541949 ATTGAATAGTAGCTTGGGGAGGG + Intergenic
1110083597 13:71347881-71347903 ATGGAATAGGAGTCAGGGGAAGG - Intergenic
1110519222 13:76455797-76455819 AAAGAGGAGGAGGATGGGGAGGG + Intergenic
1110961582 13:81632867-81632889 ATATCAAAGGAGAATGGGTAGGG + Intergenic
1110961928 13:81637634-81637656 ATAGATTTGGAGAATAAGGATGG - Intergenic
1111350828 13:87028749-87028771 ATGGAATAGTAGAATGTGCATGG + Intergenic
1111350830 13:87028768-87028790 ATGGAATAGTAGAATGTGGATGG + Intergenic
1111350833 13:87028787-87028809 ATGGGATAGTAGAATGTGGAAGG + Intergenic
1112211782 13:97384948-97384970 GGAGAATGGGAGAATGGGGAGGG + Intronic
1113030905 13:105992739-105992761 AGAGAAAAAGAGAAAGGGGAGGG - Intergenic
1114055144 14:18961964-18961986 ACAGAATAGGATGATGGTGATGG - Intergenic
1114107398 14:19439814-19439836 ACAGAATAGGATGATGGTGATGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114707358 14:24740889-24740911 ATAGAATTGGAGAATTGGCATGG - Intergenic
1114825773 14:26077085-26077107 ATAGAAAATGAAAATGGGGAGGG + Intergenic
1115752672 14:36506995-36507017 AAAGAAATGGAAAATGGGGAAGG + Intronic
1115872266 14:37817769-37817791 ATAGAGTACAAAAATGGGGAGGG + Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118110947 14:62719113-62719135 CTAGAATTAGATAATGGGGATGG + Intronic
1118472757 14:66090410-66090432 ATAGACAAAGAGAATGGGCAGGG + Intergenic
1118491322 14:66263505-66263527 GGAGCATAGGAGAGTGGGGAGGG - Intergenic
1118736601 14:68705624-68705646 ATTGATGGGGAGAATGGGGAAGG - Intronic
1119040936 14:71273980-71274002 TTAGTAAAGGAGAATGGGGTGGG - Intergenic
1119190480 14:72678699-72678721 ATAGAATAAGATGACGGGGAGGG + Intronic
1120101795 14:80453104-80453126 AAAGAATGGGAGACTGGGAAGGG - Intergenic
1120238780 14:81925305-81925327 AAAGCAGAGGAGAATGGGGGTGG - Intergenic
1120333643 14:83125704-83125726 AAAGAAGAGGAGGAAGGGGAGGG - Intergenic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1121031090 14:90659306-90659328 GGAGAAAGGGAGAATGGGGAAGG + Intronic
1121418457 14:93795645-93795667 ATATCACAGGAGAATGGGGTGGG + Intergenic
1121629672 14:95413127-95413149 AGAGAAAAAGAGAATGGGAATGG - Intronic
1121941820 14:98078089-98078111 ATAGAATTGTAGAATGGAAAGGG + Intergenic
1122579390 14:102762146-102762168 AAGGACTAGGAGAGTGGGGAGGG + Intergenic
1122579477 14:102762452-102762474 GTAGAATAGGAGGATGGGGAGGG + Intergenic
1123886783 15:24734566-24734588 AGAGAATAAGAGAATGAGGAAGG - Intergenic
1124597032 15:31099993-31100015 ATAGGAACTGAGAATGGGGAAGG - Intronic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1126048467 15:44665807-44665829 AAAGGATATGAAAATGGGGAAGG + Exonic
1126333955 15:47565728-47565750 ATAGAGTTGGAGAAAAGGGAAGG - Intronic
1126645191 15:50868682-50868704 AGAGAAAAGGAGAATGGCTATGG - Intergenic
1127908728 15:63397452-63397474 ATACAACAGGAAAATGGGCAAGG - Intergenic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1129084649 15:73076057-73076079 AGAGAATAGAAATATGGGGAGGG + Intronic
1129594563 15:76952123-76952145 ATAGGATAGGATAGTGGGGGAGG - Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130522533 15:84673533-84673555 ATGGAATGGGAGTTTGGGGATGG - Intronic
1130924566 15:88375384-88375406 GCAGAATGGGAGAATGGTGAAGG - Intergenic
1130938148 15:88487479-88487501 ATAGAAGAGGAAAATGGGCAAGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131382120 15:91972822-91972844 ATAGAAAAGGACAGTGGGGCCGG + Intronic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1133450832 16:5902741-5902763 ATAGAATAAGAGATTGATGAAGG - Intergenic
1133874715 16:9722988-9723010 TTAGAATTGGAGAAAGAGGATGG - Intergenic
1135255002 16:20934102-20934124 AAAGCATAGGAGAATAGGGAGGG + Intronic
1135776196 16:25258716-25258738 ATGGAATTGGAGAAGTGGGAGGG + Intergenic
1135936680 16:26786375-26786397 ATAGATTATGTGAAGGGGGAAGG + Intergenic
1136091161 16:27921013-27921035 ATAGAATTTTAGAATGGGTAGGG - Intronic
1136118208 16:28109219-28109241 TAATAATAGGAGAATGGGGTGGG + Intronic
1138895182 16:61195804-61195826 ATAGCATAGGTGAATGGATATGG + Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139992413 16:70950761-70950783 ATAGAATGGGAGAAACAGGAAGG - Intronic
1140117719 16:72057239-72057261 AGAGAATATGAGAAGGAGGAAGG - Intronic
1140119954 16:72074992-72075014 AGAGAATACGAGAAGGAGGAAGG - Intronic
1140816211 16:78623165-78623187 ATAGGATAGGAGTCTGGGCATGG - Intronic
1141475942 16:84273481-84273503 ATTAACTAGGACAATGGGGAAGG + Intergenic
1141577449 16:84973300-84973322 ATATATTCGGTGAATGGGGAGGG + Intergenic
1143134661 17:4704946-4704968 AGAAACTAGGAGAATGGGTAGGG - Intergenic
1143661062 17:8324902-8324924 ACAGAAGATGGGAATGGGGATGG + Intergenic
1144258330 17:13491983-13492005 ATACAATAGGAGAATAAGTAGGG + Intergenic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1147446928 17:40480203-40480225 ACAGAAGACAAGAATGGGGAAGG + Intronic
1147670674 17:42175117-42175139 ACAGAAGAGGTGAATGGGGGTGG - Intronic
1148321628 17:46759209-46759231 ATAAAATAAGTGACTGGGGAAGG + Intergenic
1148403964 17:47395031-47395053 ATGGATTAGGAGAAAGCGGAGGG - Intronic
1150139244 17:62714742-62714764 AAAAAAGAGGAGAAGGGGGAGGG - Intronic
1150664057 17:67113702-67113724 ATAGGATAATAGAATGTGGAAGG + Intronic
1151443528 17:74148811-74148833 AAGGAATAGGATGATGGGGAAGG - Intergenic
1153277594 18:3383161-3383183 AAAGAATAGCACAGTGGGGAAGG - Intergenic
1153704455 18:7731461-7731483 ATAGAATAGTAGAGTTAGGAGGG + Intronic
1153803817 18:8694731-8694753 ATAGAATAGCATAATTAGGAAGG - Intergenic
1154104828 18:11513042-11513064 AGAGAATAGAAGAATGGGAAAGG + Intergenic
1155294356 18:24371674-24371696 AGTGAAGAGTAGAATGGGGAGGG - Intronic
1155402104 18:25450243-25450265 AAAGAAAAAGAGTATGGGGAAGG + Intergenic
1156436710 18:37138628-37138650 CAAGAAGAGGAGAATGGGGGCGG - Intronic
1156458259 18:37306802-37306824 TAAGGAGAGGAGAATGGGGAGGG + Intronic
1157149116 18:45197252-45197274 ATAGAACAGGTGAATGAGAAAGG - Intergenic
1157321622 18:46639257-46639279 AAAGGATAGGAAAATGGGGAAGG + Intronic
1157419610 18:47534748-47534770 ATATAATATTAGAATGGTGAAGG + Intergenic
1158949101 18:62475346-62475368 ATAGAATAGGGCACTGGGGCTGG - Intergenic
1159223549 18:65499391-65499413 ATAGAATACCAGAGTTGGGAGGG - Intergenic
1159306466 18:66649812-66649834 ATTAAATAGGAGAAAGGTGATGG + Intergenic
1159409296 18:68050682-68050704 AAAGGATAGGAGAGTGGTGAGGG - Intergenic
1159684813 18:71405399-71405421 ATAGGAAGAGAGAATGGGGAGGG + Intergenic
1160237678 18:77098961-77098983 AGAGAAGAGGAGAAGAGGGAGGG - Intronic
1160283772 18:77519073-77519095 ATAGGAGAGGAGAATGGGGAGGG - Intergenic
1161779938 19:6285246-6285268 ATCGAAAAGAATAATGGGGAAGG + Intergenic
1161958012 19:7506904-7506926 ATGGATTAGGAGAGGGGGGAGGG - Intronic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1162297409 19:9822793-9822815 AGAGAAGAGGAAAATGGGGCCGG - Intronic
1163674296 19:18647668-18647690 AAAGAACAGGAGAATGGGGAGGG + Intronic
1164667543 19:30051517-30051539 ACAGAAAAGGAGGAGGGGGAAGG - Intergenic
1164729870 19:30495439-30495461 CTAGGAAAGGAAAATGGGGAAGG + Intronic
1165580660 19:36860412-36860434 ATAGATGAGGAGAAAGGGTAGGG - Intronic
1166558103 19:43715035-43715057 CTACAAGAGGAGAATGGAGAAGG + Intergenic
1168272563 19:55258235-55258257 AGAGATTAAGAGACTGGGGAGGG + Intronic
1168329822 19:55561219-55561241 ATAGAATAGGGGAACAGTGATGG - Intergenic
1168350285 19:55671603-55671625 TTAGAAAAGGGGCATGGGGAAGG + Intronic
925068517 2:949545-949567 AGAGAATAGAGAAATGGGGAAGG + Intergenic
925247994 2:2401884-2401906 ATAGAACAGGAGAATCAGAAAGG - Intergenic
925918785 2:8625467-8625489 AGAAAATAGAAGACTGGGGAAGG + Intergenic
926178309 2:10616882-10616904 GTTGAATAAGTGAATGGGGAGGG - Intronic
926530739 2:14041440-14041462 ATATAATAAGAGAAGGGGAAGGG - Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927385627 2:22530611-22530633 ATAGAATTGTAGAATTGGAAGGG - Intergenic
927466752 2:23342463-23342485 ATTGAATTGGAGAAAGGAGAAGG + Intergenic
928011562 2:27613016-27613038 AAAGAAAAGGGGAATGGGAATGG - Intronic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928644639 2:33339136-33339158 AGAGAATAGGAGAAAGTGAAGGG + Intronic
929210320 2:39349720-39349742 AAAAAAGAGGAGAAGGGGGATGG + Intronic
929882949 2:45853156-45853178 ATAAGAAAGGAGAATGGGGAGGG - Intronic
930083996 2:47480037-47480059 GGAGAATGGGAGAAGGGGGAAGG - Intronic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
933861340 2:86472432-86472454 ATAAAATAGGAGTAGGGGTAGGG + Intronic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934860017 2:97756983-97757005 AAAGAAGAGGAGGGTGGGGAGGG + Exonic
934959847 2:98662502-98662524 ATAGAATTTCAGAATGGGAAAGG - Intronic
935279653 2:101506452-101506474 GTGGAAGAGGAGGATGGGGAAGG + Intergenic
935308361 2:101759557-101759579 AGAGAGGAGGGGAATGGGGAGGG - Intronic
938049777 2:128158180-128158202 GTAGGGTAGGAGAATGGGGAAGG + Intronic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
939898592 2:147823188-147823210 ATAGCACAAAAGAATGGGGAGGG + Intergenic
940346759 2:152636770-152636792 TTAGAAAAGGACAATGAGGACGG - Intronic
940363232 2:152818081-152818103 ATGTAAGAGGAGGATGGGGAGGG + Intergenic
940740001 2:157496708-157496730 AAAGAATAGGGGAATGGGAATGG - Intergenic
940875567 2:158894008-158894030 ATAGGAGGGGTGAATGGGGAGGG - Intergenic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
942118412 2:172751423-172751445 ATAGAATAGGAGAAGTTAGATGG + Intronic
942918188 2:181337993-181338015 ATAAAATTGGAGAAAGGAGAGGG + Intergenic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944343259 2:198629666-198629688 ATAGAAATGGAGAAAGTGGACGG - Intergenic
944509878 2:200453990-200454012 GCAGAATGGGAGCATGGGGAGGG - Intronic
945188293 2:207161806-207161828 AAACAATAGGGGAATGGGGGAGG + Intronic
945264938 2:207881772-207881794 AAAGAGTAGGAGAAAGGGAAGGG - Intronic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
947939956 2:234044681-234044703 AGAGAATAGGGGTTTGGGGAAGG + Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169501254 20:6162939-6162961 ATAGATCAGGAGAATGAAGAAGG - Intergenic
1170181285 20:13533015-13533037 CTAGACTAGGAAAAAGGGGAAGG - Intronic
1170343974 20:15362930-15362952 AGAGAAGAGGGGAAAGGGGAGGG + Intronic
1173001813 20:39110411-39110433 AGAGAATAGGAGAGAGGGAAAGG - Intergenic
1174428388 20:50449553-50449575 ATAGAAGAGGATACTGGGGATGG - Intergenic
1174835551 20:53853355-53853377 ATAGAATAGAGCAAAGGGGATGG - Intergenic
1175061601 20:56248682-56248704 CTAGAATAAAAGGATGGGGAGGG - Intergenic
1176980456 21:15375678-15375700 AGAGAAGAGGGGAATGGGGCGGG - Intergenic
1177477079 21:21637257-21637279 AGAGAATACTAGACTGGGGAGGG - Intergenic
1178069732 21:28950880-28950902 AGAGATTAGGACAATGGGAAGGG + Intronic
1179170885 21:38971905-38971927 ATAGAAACGGAGAGTAGGGAAGG - Intergenic
1179384709 21:40931076-40931098 AGAGAATTGGAGGACGGGGATGG + Intergenic
1180473626 22:15684514-15684536 ACAGAATAGGATGATGGTGATGG - Intergenic
1182167478 22:28190903-28190925 GTAGAATAGAAGAATGGAGAGGG - Intronic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1183340509 22:37278069-37278091 AGAGAAAATGAGAAAGGGGAAGG + Intergenic
1183759242 22:39800391-39800413 AAAGAATAAGAGAATAGAGAGGG - Intronic
1184204156 22:42990477-42990499 ATACATGAGGAGTATGGGGACGG + Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949677081 3:6467668-6467690 ATAGTATAGGATAATGGTTAGGG + Intergenic
949736869 3:7183004-7183026 ATAGAATAGCATAGTGGGGGTGG + Intronic
950040722 3:9917551-9917573 GTAGAAGAGAAGAACGGGGAAGG + Exonic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
950318434 3:12026484-12026506 CTAGAATAGGAGGCTGGGGAAGG + Intronic
950456970 3:13098526-13098548 CTAAAATAGGAGGATGGAGAGGG + Intergenic
950806936 3:15613123-15613145 ATAGAATATGACAAAGGTGAAGG - Intronic
950837598 3:15935733-15935755 AGAGAATAGGAGAAACGAGAGGG - Intergenic
950945937 3:16946179-16946201 ATAGAAGAGAAGAAGGGGAAAGG + Intronic
951008305 3:17645896-17645918 ATAGAGTAGGAGATCGGGAAGGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951946033 3:28137363-28137385 ATAGAATAGGTGAAGGATGATGG + Intergenic
952206244 3:31183787-31183809 ATAAAATGGGAAAATGTGGAAGG + Intergenic
952699437 3:36310409-36310431 AGAGAATATGGGAATAGGGAGGG - Intergenic
952875951 3:37944608-37944630 TCAGAATAGGAGAAGTGGGAAGG - Intronic
953575790 3:44112227-44112249 AGAGAGGAGGAGAATAGGGAGGG + Intergenic
953724380 3:45384911-45384933 AGAGGATAGGGTAATGGGGAGGG - Intergenic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
955423987 3:58768542-58768564 ATAGACTAGGATAATGGCAATGG - Intronic
955833129 3:63025972-63025994 AAAGAATATGAGATTTGGGAGGG - Intergenic
955978226 3:64498367-64498389 AAAGCAGAGGAGAATGGGGCAGG - Intergenic
956064012 3:65378043-65378065 ATACAATGGGAGAAGGGGAAGGG - Intronic
956131505 3:66057798-66057820 ATAGAATATCAGAATGAGGGTGG + Intergenic
956429664 3:69173150-69173172 ATAGGAAAGGAGAAAGGGAATGG + Intronic
956857900 3:73294096-73294118 ATAGATGAGGAAAATGTGGATGG + Intergenic
957121413 3:76099195-76099217 ATAGAAGAGGAGAAAAGGAACGG - Intronic
957163876 3:76645586-76645608 AGAGAATAAGAGAGTGGGCAGGG + Intronic
957853233 3:85838788-85838810 TTACAATAATAGAATGGGGAGGG + Intronic
958701412 3:97595733-97595755 ACGAAATAAGAGAATGGGGAAGG + Intronic
958812670 3:98879746-98879768 AAAAAATAGGAGGAGGGGGAAGG - Intronic
959105116 3:102056989-102057011 GGAGAAAGGGAGAATGGGGAAGG + Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959932762 3:112001090-112001112 ATAGAACATAACAATGGGGAAGG - Intronic
960525725 3:118707546-118707568 ATAGAATGTCAGAATGGAGAGGG - Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
963060308 3:141220172-141220194 GTAGAATAGGAGTCTGGGGAAGG - Intergenic
963139179 3:141933569-141933591 ATTGAACACAAGAATGGGGATGG + Intergenic
963265241 3:143233650-143233672 AAAGAACAGGAAAATGGTGAGGG - Intergenic
964985070 3:162727231-162727253 ATTGAATAGGGGGAGGGGGAGGG - Intergenic
965069144 3:163895120-163895142 ATTAAATAGCAGAAGGGGGAAGG + Intergenic
966462184 3:180189059-180189081 CAATAATAGGAGAATGGGGAAGG - Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967847922 3:194058552-194058574 AGAGAAGAGGGGAGTGGGGAGGG + Intergenic
968719392 4:2189221-2189243 ATAGAATAGCTGAATGGATAAGG + Intronic
970099147 4:12501342-12501364 AAAGAAAAGGAGAAGGGGAAGGG + Intergenic
970477146 4:16435176-16435198 ACAGAATAGGAGAAGGGGTTGGG + Intergenic
970768581 4:19582331-19582353 AAAGAATGGGAAAATGAGGAAGG - Intergenic
970838054 4:20434498-20434520 AAAGAAGAAGAAAATGGGGAAGG + Intronic
971111716 4:23592560-23592582 TTAGGATAGGAGATTTGGGAAGG + Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971167455 4:24198716-24198738 CTGGAATAAGGGAATGGGGAAGG + Intergenic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
971423433 4:26493917-26493939 ACAGAATAGGAAAAAGGGAAAGG - Intergenic
972305026 4:37822703-37822725 ATAGAATAGTAGATTGAAGAAGG - Intergenic
972838691 4:42905857-42905879 ATAGCATGGGAGGATGGGGTTGG + Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974690027 4:65286740-65286762 ATAAAATAGGAGTATTTGGAGGG - Intergenic
974699286 4:65418731-65418753 AAAGAATAAAACAATGGGGAGGG - Intronic
975393093 4:73842950-73842972 AGAGAAGAGGAGAAGAGGGAAGG - Intronic
975416519 4:74111601-74111623 CTAGAACATAAGAATGGGGAAGG + Intergenic
976046702 4:80956736-80956758 AGAGAAAAGGAGATTGGGCATGG - Intronic
976196230 4:82534675-82534697 ATAGAATTGGAGCAGAGGGAGGG + Intronic
976572986 4:86635003-86635025 ACAGAACTGGAGAATGGGGGTGG - Intronic
977463423 4:97355235-97355257 GTAGAAAAGGAGACTGGGCACGG + Intronic
977773584 4:100889967-100889989 AGAGAATAGTGGACTGGGGAAGG + Intergenic
978324774 4:107540070-107540092 AAAAAATAAAAGAATGGGGAAGG + Intergenic
978509193 4:109497099-109497121 ATAACATAGAAGAATGGGCATGG - Intronic
979603304 4:122609395-122609417 ATAAATTGAGAGAATGGGGAGGG + Intergenic
979630816 4:122900435-122900457 ATAGCATAGGAGATTGGTCAGGG - Intronic
981658107 4:147135224-147135246 AAAAAGTAGGAGAAAGGGGAAGG - Intergenic
982353657 4:154443789-154443811 TTTGGATAGCAGAATGGGGAGGG - Intronic
982742158 4:159068786-159068808 ATAGAAAAGGTAAATTGGGATGG + Intergenic
983759243 4:171384894-171384916 AAAGAAGAGGAGGAAGGGGAAGG - Intergenic
983915478 4:173287249-173287271 ATAGCATCAGAAAATGGGGAAGG - Intronic
986092640 5:4525255-4525277 AAAGAATAAGGGAATGGTGAAGG + Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988046334 5:25960379-25960401 ATAGAATAGGAGAGTGTAGCAGG + Intergenic
989959668 5:50396758-50396780 ATAGAAAAGGAGACTGAGGTAGG + Exonic
989970142 5:50513861-50513883 GGAGAAAAGGGGAATGGGGAGGG - Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990470077 5:56107350-56107372 GCAGAATAGCAGAAAGGGGAAGG - Intronic
990789320 5:59458859-59458881 ATAAAATATGAGATTGGGGAAGG - Intronic
990981024 5:61602603-61602625 CCAGAAGAGGAGAATGGGGGTGG - Intergenic
991166477 5:63569360-63569382 CTAGAACAGGAGAAGGGGAAGGG - Intergenic
991183267 5:63778970-63778992 AGAGAATGGGAGAAAGGGGAGGG + Intergenic
993426713 5:87774137-87774159 ACAGCCTTGGAGAATGGGGAAGG - Intergenic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994593212 5:101798255-101798277 ATAGCATAGAAGAATTTGGAGGG - Intergenic
995245734 5:109933233-109933255 AAAGAATATGAGAGTGGGGCTGG - Intergenic
995294138 5:110499135-110499157 ATAGAAAAGGAGAAAGAGCAGGG + Intronic
995849156 5:116526217-116526239 ATAGAAAAGTGGAGTGGGGAGGG - Intronic
996874634 5:128227289-128227311 GTAGATTAGAAGAATGGAGATGG + Intergenic
996963205 5:129276181-129276203 ATAGAAAAGGAGGCTGGGCATGG - Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
998265016 5:140661587-140661609 ACAGAATCGGGGGATGGGGAAGG - Intronic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
999733635 5:154495344-154495366 ATAGAATATGTGACTGGGCACGG - Intergenic
999827308 5:155286168-155286190 AGAGAATGGAAGAAGGGGGAGGG - Intergenic
1000726695 5:164780308-164780330 ATAAAATAGCAGAAGTGGGAAGG - Intergenic
1001227117 5:169954579-169954601 ATAAAATAGAAGAACAGGGATGG - Intronic
1001370404 5:171194291-171194313 ATAGAATTAGATAATGGTGATGG - Intronic
1001539577 5:172527954-172527976 ATGGAATAGGAAAGAGGGGAAGG + Intergenic
1001667949 5:173448957-173448979 AGAGGCTAGGAGACTGGGGATGG + Intergenic
1001803330 5:174562198-174562220 ATACAATAAAGGAATGGGGAAGG - Intergenic
1002346274 5:178549472-178549494 AGAGAATAGGGGAATGGGAGAGG + Intronic
1002977383 6:2095095-2095117 ATAGAATATGAGAATATGTACGG - Intronic
1003044248 6:2718354-2718376 TTAGAATAGAAGAAGGGAGAAGG - Intronic
1003095319 6:3138306-3138328 AAAGAATAGGAGGCTGGGCATGG - Intronic
1003610190 6:7606533-7606555 AAAGAATAAGAGAAAGAGGAAGG - Intronic
1004533201 6:16473850-16473872 ATAGCATAGGAGAAGATGGAAGG - Intronic
1005313246 6:24579655-24579677 ATAGAATAGACGAAAGGTGAAGG + Intronic
1006334250 6:33412178-33412200 AAAGAAAAAGAAAATGGGGAAGG + Intronic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1007236512 6:40394363-40394385 AGGGAATAGGAGAATGGGAGTGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007739784 6:44003342-44003364 AGAGACTGGGAGAGTGGGGAGGG + Exonic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1007855733 6:44854550-44854572 ATAGAATGGGAAAAAGGAGAAGG - Intronic
1008174970 6:48256833-48256855 ATAGAAGAGGTGATTGGGGCAGG + Intergenic
1008416566 6:51247596-51247618 ATAGAATTGGGAAATGGGAAAGG + Intergenic
1008458215 6:51736769-51736791 ATAAAATGGGAGATTGGAGAGGG - Intronic
1009462459 6:63930827-63930849 ATAGACTAGGATAAAGGGGTGGG - Intronic
1010216310 6:73405238-73405260 ATGGAATAGCAGAATGGTTAAGG + Intronic
1012353309 6:98280418-98280440 AAAGAATAGAAGAATGGAGGTGG - Intergenic
1013851697 6:114523710-114523732 ATGGAATGGGAGAAGGTGGAAGG + Intergenic
1014108995 6:117599612-117599634 AGATCATAGGAAAATGGGGAGGG - Intronic
1014150997 6:118055063-118055085 AAAGAATGGGAGGATGGGCACGG - Intronic
1014916427 6:127155075-127155097 ATAAAACAGGAGAATGGGAAAGG - Intronic
1016487995 6:144564751-144564773 ACATAATTGGATAATGGGGATGG - Intronic
1017359601 6:153552026-153552048 ATAGAATAGGAGGATATGAAAGG + Intergenic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020462828 7:8443304-8443326 AAAGAATGGGAGACTGGGTAGGG - Intronic
1021497755 7:21294703-21294725 ATAGCATATGAGTAGGGGGAGGG + Intergenic
1021817436 7:24461504-24461526 ATAGAAGAGGAAAAGGCGGAAGG + Intergenic
1021914126 7:25414638-25414660 ATCTCATGGGAGAATGGGGAGGG - Intergenic
1022607950 7:31834832-31834854 TTAGAATACGAGATTTGGGAGGG + Intronic
1023106751 7:36770480-36770502 GTAGAACAGGATAAGGGGGATGG + Intergenic
1025246278 7:57319893-57319915 ACAGAAGAGGATAGTGGGGATGG + Intergenic
1026228481 7:68463018-68463040 AGAGAAGAGGAGAAGAGGGAAGG - Intergenic
1026715400 7:72784846-72784868 ATTGAATTGGAGAATGGGTTAGG - Intronic
1027987062 7:85306726-85306748 ATAGAATTTTAGAATTGGGAAGG + Intergenic
1028246745 7:88488397-88488419 AAAGAAGAGGAGAATGAGAAAGG - Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1030087172 7:105826374-105826396 ATAGAATTGGACAGTTGGGAAGG - Intronic
1030835154 7:114275258-114275280 ATACAAGAGGAGAATAGAGAGGG - Intronic
1031536992 7:122946872-122946894 AGAGAAGAGGGGAAGGGGGAAGG + Intergenic
1032185077 7:129717772-129717794 ACAGAATAGGATAAACGGGAAGG - Intronic
1032692700 7:134304918-134304940 AGAGAATAGGAACATGGGCAAGG + Intronic
1032746946 7:134795606-134795628 AAAGAAAAGGAGGAGGGGGAAGG - Intronic
1033168133 7:139059153-139059175 GCAGAGTAGGAGGATGGGGAGGG - Intronic
1036413634 8:8526625-8526647 AAAGAATAAGAGAATAGGGCCGG - Intergenic
1036767687 8:11559084-11559106 ATTGAATAGGAGACAGCGGAGGG - Intronic
1036938617 8:13030235-13030257 ATAGAAAAGGAGCATGAAGATGG - Intronic
1038133129 8:24756383-24756405 AGAGAAGAGGAGAAAGGGGAAGG + Intergenic
1038163173 8:25059887-25059909 ACAAGATAGGAGAATGAGGAAGG - Intergenic
1038245919 8:25855925-25855947 ACAGAATAGGAAAAAGAGGAAGG - Intronic
1039732831 8:40298239-40298261 ATAAAAGAGGAGCATGTGGAAGG - Intergenic
1039735884 8:40332381-40332403 ATAGCTCAGGAGACTGGGGAAGG + Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1040745743 8:50640262-50640284 TCAGAATAGGACAGTGGGGAGGG - Intronic
1040819212 8:51536509-51536531 AAAGCAAAAGAGAATGGGGAGGG + Intronic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1042444580 8:68869223-68869245 AAAGAAGTGGAGAAAGGGGAAGG - Intergenic
1042695856 8:71554691-71554713 ATTGGATAGGAGACTGGGGGAGG + Intronic
1044159200 8:88891877-88891899 GTTTAATAGGAGAATGGGGGTGG + Intergenic
1045744913 8:105406966-105406988 ATAGAACAGTGGAATGAGGAAGG + Intronic
1046100557 8:109609610-109609632 ATGGAAAAGGAGAATAGAGAAGG - Intronic
1046820861 8:118632851-118632873 ATAGAACAGAAGAAAGGAGAAGG - Intergenic
1047061550 8:121232427-121232449 ATGGAATAGAAGAATGGTGGTGG - Intergenic
1047830346 8:128622629-128622651 ATACAATAGCAGAATAGGGATGG + Intergenic
1048755720 8:137735801-137735823 ATTGAATAGGAGATAGGGAATGG - Intergenic
1050368155 9:4892030-4892052 TCATAATAGGAGAATAGGGATGG + Intergenic
1050670453 9:7990804-7990826 ATAAAAGAGCAGAATTGGGAAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051516391 9:17934832-17934854 CTTGAATAGGCAAATGGGGATGG - Intergenic
1051653485 9:19354041-19354063 GTAGAATAGGGGAATGAGGGTGG - Intronic
1052624269 9:30954875-30954897 ATAGAATAGAAAGATGGGAATGG + Intergenic
1053573279 9:39331880-39331902 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1053624636 9:39856112-39856134 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1053880234 9:42587116-42587138 TCTGTATAGGAGAATGGGGAAGG - Intergenic
1053892430 9:42707210-42707232 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1054094849 9:60890586-60890608 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054116316 9:61166490-61166512 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054123865 9:61287131-61287153 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1054219260 9:62394586-62394608 TCTGTATAGGAGAATGGGGAAGG - Intergenic
1054231454 9:62514587-62514609 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1054591443 9:67016054-67016076 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1055228768 9:74034558-74034580 CTAGAATATGAGGATAGGGATGG - Intergenic
1055510723 9:76993396-76993418 ATAAAAGATGAGAGTGGGGATGG - Intergenic
1056873639 9:90307096-90307118 AAAGAATAGAACATTGGGGATGG - Intergenic
1057072358 9:92110343-92110365 ATCGAATAGGAGAAATGTGATGG - Intronic
1057544238 9:96005436-96005458 AGAGAATAATAGGATGGGGAGGG + Intronic
1057840964 9:98485286-98485308 ATGGGGTAGGAAAATGGGGAGGG + Intronic
1058504044 9:105651451-105651473 ATAGAATTGGAGATTGGTAAAGG + Intergenic
1058568632 9:106315062-106315084 ATAGAAAAGGAATTTGGGGAGGG - Intergenic
1058569584 9:106326284-106326306 AGAGAATATGAGAATGAGAATGG + Intergenic
1059423214 9:114205621-114205643 ATGGAACAGGAGGAAGGGGAGGG - Intronic
1060445896 9:123687805-123687827 ACAGAATAGGAGAATCTGGTGGG - Intronic
1060961843 9:127686319-127686341 ATAGCATAGGAGCACAGGGAGGG + Intronic
1185472169 X:390535-390557 ATAAAAAGCGAGAATGGGGAGGG + Intergenic
1185762285 X:2697887-2697909 ATAGAATAGCAGGACAGGGAGGG + Intronic
1186108564 X:6231247-6231269 AGAGAAAAGGAGAAAGGGAAGGG + Intergenic
1186420948 X:9425972-9425994 TGGGAATAGAAGAATGGGGAAGG + Intergenic
1186972921 X:14868590-14868612 AGAGGATGGGAGGATGGGGAGGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1188464675 X:30466414-30466436 ATAGAAGAGGAGAATGCTGAGGG - Intergenic
1188742266 X:33800428-33800450 ATAAAATAGGAAAATAGTGAAGG + Intergenic
1190220090 X:48507337-48507359 ACAGAAAAGGACAATGGAGACGG + Intergenic
1190436695 X:50432866-50432888 ATAGAAAAGAAGAAGGGGGGAGG - Intronic
1190497026 X:51036529-51036551 AAAGACTGGAAGAATGGGGAGGG - Intergenic
1191676282 X:63795333-63795355 AAAGAAGAGGAGGAGGGGGAAGG + Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1192143922 X:68667896-68667918 ATGGCTTAGGAGAATGGGGCAGG - Intronic
1193234004 X:79084363-79084385 ATAGGATAGGAGCCTGGGGAAGG - Intergenic
1193574698 X:83183636-83183658 ATAAAATAGGAGAATGGGAAAGG - Intergenic
1193982699 X:88203421-88203443 AGAGAATAGGTGAATGAGGCAGG + Intergenic
1194439793 X:93918188-93918210 CTAGTTTAGTAGAATGGGGAGGG - Intergenic
1194825127 X:98552503-98552525 ATAGAATAAGAGAAGGAGAATGG + Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1197497949 X:127208903-127208925 CTATATTAGGAGAATGGGAAGGG + Intergenic
1197784808 X:130188905-130188927 ATAAAATAGGAGGCTGGGCATGG - Intergenic
1197915642 X:131531395-131531417 ATATAATAGGAGTATGGGTATGG - Intergenic
1198222299 X:134613734-134613756 ATAGAAACAGAGAAAGGGGAAGG - Intronic
1198381566 X:136088742-136088764 AAAGAAAAGAAAAATGGGGAGGG - Intergenic
1199137563 X:144271035-144271057 AGACAATAGGATCATGGGGACGG - Intergenic
1200009454 X:153110164-153110186 ATTCAATAGGAGATTTGGGAGGG - Intergenic
1200030146 X:153289758-153289780 ATTCAATAGGAGATTTGGGAGGG + Intergenic
1200360005 X:155594576-155594598 ATAGAATAGGAGTATAATGATGG + Intronic
1200981211 Y:9264695-9264717 ACAGAATAGGGGGATGGGAATGG + Intergenic
1202129210 Y:21595046-21595068 ACAGAATAGGGGGATGGGGTTGG - Intergenic