ID: 1125805628

View in Genome Browser
Species Human (GRCh38)
Location 15:42491116-42491138
Sequence GTGCGCCTGCGCGTTGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125805628 Original CRISPR GTGCGCCTGCGCGTTGGCGG CGG (reversed) Intronic
906203549 1:43975085-43975107 CTGGGCCTGCGCGCTGGCCGTGG + Exonic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
911002572 1:93180885-93180907 GAGCGACTGCGCCTTGGCGTGGG + Intronic
912009434 1:104940716-104940738 GTGAGCCTGGGCAATGGCGGGGG + Intergenic
914422275 1:147540387-147540409 GTGGGCCTGAGAGTTGGAGGAGG - Intergenic
1064283422 10:13971057-13971079 GTGCACCTGTGTGTTGGGGGTGG - Intronic
1076373910 10:129971355-129971377 GTGCGTCGGCGCGGGGGCGGGGG + Intergenic
1076710620 10:132331938-132331960 GTGCGCCTGCGCTGGGGCGGGGG - Intergenic
1076880409 10:133236903-133236925 GGTCGCCTGCGCGTCGGCGTGGG - Intergenic
1077038659 11:507577-507599 GTGCGGCAGCGCCTTGGGGGCGG + Intergenic
1079291132 11:19188654-19188676 GTGGGCGCGCGCGTTGGCAGGGG + Intronic
1083995242 11:66268570-66268592 TTGCGCCTGCGCGTCGCGGGCGG + Exonic
1084372161 11:68751310-68751332 GGGCCCCTGCGGGTGGGCGGAGG - Intronic
1084484279 11:69438897-69438919 GTGCACCCGGGCGCTGGCGGTGG - Intergenic
1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG + Intronic
1085485665 11:76860947-76860969 GAGCGCCTGGGCGGCGGCGGCGG + Exonic
1088821882 11:113463633-113463655 GTGTGCATGCGTGTTTGCGGGGG + Intronic
1092521796 12:9283643-9283665 GTGCGCATGCGCAGCGGCGGGGG + Intergenic
1092545488 12:9448213-9448235 GTGCGCATGCGCAGCGGCGGGGG - Intergenic
1094507465 12:31073838-31073860 GTGCGCATGCGCAGCGGCGGGGG + Intronic
1099945440 12:89238708-89238730 CTGGGCCTGCGCTTTGGCAGGGG + Intergenic
1102524737 12:113504128-113504150 GTGAGCCTGTGGGTTGGCTGTGG - Intergenic
1104376026 12:128266546-128266568 GTGCACCTGTGCGTGTGCGGAGG - Intergenic
1106248770 13:27968725-27968747 GTGAGCCACGGCGTTGGCGGCGG + Exonic
1108403996 13:50081656-50081678 GGGCGTCTGCGAGTGGGCGGCGG - Intergenic
1110568598 13:76980323-76980345 GAGCGCTGGCGCGTTGGCGATGG + Intergenic
1112415526 13:99200828-99200850 GTGCGCCTGCGCGGTCGCTGGGG + Exonic
1117875927 14:60249719-60249741 GCGGGCCTGCGCGGCGGCGGCGG + Intronic
1120862545 14:89267799-89267821 GTATGCGTGCGTGTTGGCGGTGG + Intronic
1122411796 14:101529385-101529407 GTGAGCCTGCGTGTGGGAGGAGG + Intergenic
1122663151 14:103311281-103311303 GTGCGCCTGTGTGTTGGGGACGG + Intergenic
1122930737 14:104932070-104932092 GTGCGCCTGCTGGTCGGCTGCGG + Exonic
1124392288 15:29269870-29269892 GTGCGCCTGCGCGGCTGCGGCGG + Intronic
1125805628 15:42491116-42491138 GTGCGCCTGCGCGTTGGCGGCGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1134482311 16:14630285-14630307 CAGCGCCTGCGCGGCGGCGGGGG + Intronic
1136541042 16:30927841-30927863 TTGCGCCTGGGCGGGGGCGGTGG - Exonic
1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG + Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143565427 17:7717658-7717680 GGGCGCCTGCGCGGAGGAGGCGG + Exonic
1145197641 17:20908662-20908684 GCGCGCCTGCGCGTGGGGGGGGG - Intergenic
1148397736 17:47323823-47323845 GAGCCCCTGGGCGGTGGCGGTGG + Intronic
1151826944 17:76529057-76529079 GTGCGCCTTTGCGTGGGTGGGGG - Intronic
1151970080 17:77453169-77453191 GTGCGCCTGGGGGGTGGCGTGGG + Intronic
1152034746 17:77865212-77865234 GTGCGCCCGCGCGTGTGCGTGGG - Intergenic
1153931788 18:9885589-9885611 GTGCGCCTGGGAGGTGGGGGAGG + Intergenic
1156275707 18:35581450-35581472 GTGCGGCTGCGCGGGGGAGGCGG - Intronic
1157419370 18:47532098-47532120 GTGCTACTGCGCGTTGGGTGGGG + Intergenic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160909402 19:1467868-1467890 GTGCGCCGGTGGGTTGGCGTGGG - Exonic
1162586043 19:11559149-11559171 GTGCGAGTGGGCGTTGGGGGTGG - Intronic
1162742688 19:12782649-12782671 GTGCGCGCGTGCGTGGGCGGTGG + Intronic
1163592828 19:18203978-18204000 GTGGGGCTGCGCGGCGGCGGCGG + Exonic
1168227244 19:55004589-55004611 GTGTGTGTGCGCGTTGGGGGAGG - Intergenic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
929974314 2:46617037-46617059 CTGCGCCTGCGCGTGGGCCTGGG - Exonic
936228277 2:110678101-110678123 GGGCGCCTGCCCATTGGTGGCGG + Exonic
936467319 2:112764873-112764895 GTGCGCCTCCGAGTGGGCGTGGG + Intergenic
937254591 2:120546279-120546301 GTGCGTGTCCTCGTTGGCGGCGG + Intergenic
945148709 2:206765331-206765353 GTGCGCCTGCGCCTTGCCCTTGG - Exonic
946921464 2:224585293-224585315 GCGCTCCTCCGCGATGGCGGCGG + Exonic
1168811926 20:710128-710150 GTGCGCCCGAGCGTGGGCCGTGG + Intergenic
1173741910 20:45407274-45407296 GTGCGGCCGCGGGCTGGCGGCGG - Intronic
1176295428 21:5069604-5069626 GTGCTCATGCACGGTGGCGGGGG + Intergenic
1178961853 21:37073090-37073112 GTGCGCCTGCGCCAGGGTGGGGG - Intronic
1179796757 21:43789495-43789517 GTGCGCCTGGGCGGTGTCGCGGG + Exonic
1179861622 21:44192520-44192542 GTGCTCATGCACGGTGGCGGGGG - Intergenic
1180246074 21:46548214-46548236 GTGCGCCTGCGTGCAGGGGGAGG + Intronic
1182067589 22:27441709-27441731 GTGGGCCACCGCGTTGGCTGAGG - Intergenic
1183368493 22:37419512-37419534 GTGGGCCTGCGTGTTGGGGAGGG - Intronic
950045713 3:9947563-9947585 GCGCGGCTGGGCGTTCGCGGGGG - Exonic
954408680 3:50359523-50359545 CTGCGCCTGCGCGTCCCCGGCGG + Exonic
960717956 3:120596262-120596284 GTGCGCCTGCGCGTTAGCAGAGG - Intergenic
965735010 3:171810419-171810441 TAGCACCTGCGCGTTGGCGGCGG + Exonic
967171791 3:186827562-186827584 GTGCGCCTGCGCGAGCGCGGCGG + Intergenic
968591499 4:1462037-1462059 GTGCTCCTGAACCTTGGCGGGGG + Intergenic
968832398 4:2939781-2939803 GTGCGCCTACCGGTGGGCGGGGG + Intronic
983919812 4:173333832-173333854 GTGCGCCGGGGCGCGGGCGGGGG - Intronic
999268822 5:150284553-150284575 GGGCGGCTGCGCGGGGGCGGAGG + Intronic
999318565 5:150599689-150599711 GTGAGCCTGGGGGTCGGCGGTGG + Intergenic
999328278 5:150656764-150656786 GAGCGCATGCGCGGGGGCGGGGG - Intronic
1001834456 5:174819962-174819984 GTGAGCCTGCAGGTTGGCTGGGG - Intergenic
1002524168 5:179806433-179806455 GCGCACCTGGGCGTCGGCGGCGG - Intronic
1006694742 6:35921184-35921206 GCGCGCTTGCGCGTTGGGCGCGG + Exonic
1008370379 6:50724187-50724209 GTGCGCCTGTGAGTTGGGTGGGG - Intronic
1012474808 6:99607007-99607029 GAGCGCCTGCCTGGTGGCGGCGG + Exonic
1017170723 6:151452146-151452168 GTGCGGCTGCGCAGTAGCGGGGG - Intronic
1017206398 6:151808109-151808131 GTAGACCTGCGCGTTGGCGGCGG - Exonic
1019404504 7:876633-876655 GAGCGCCGGCCCGATGGCGGCGG + Exonic
1020020245 7:4862058-4862080 GTGAGCCCTCGCGCTGGCGGCGG - Intronic
1025810185 7:64870671-64870693 GTGTGCCTCCGCTTTGGCTGTGG + Intronic
1033155588 7:138954490-138954512 GAGAGCCTGCGCTTTGGCAGGGG - Intronic
1035553013 8:544650-544672 CTGCGCCTGGGCGGCGGCGGCGG + Exonic
1037815946 8:22111948-22111970 GTGCGCATGTGCGGTGGGGGTGG + Intergenic
1046792153 8:118333827-118333849 GTGTGTGTGCCCGTTGGCGGGGG + Intronic
1049083082 8:140457761-140457783 CTGCTCCTGCGCGTGCGCGGAGG + Intronic
1049844288 8:144792537-144792559 GTGCGCCTGCGCGGGGGCCCTGG - Exonic
1057313422 9:93955161-93955183 CTGCGCCCGCGGTTTGGCGGCGG + Exonic
1059119726 9:111631289-111631311 GTGCGCCTGCGCGGAGGCGTCGG + Intergenic
1062013326 9:134278411-134278433 GTGGGCCTGTGGGTGGGCGGTGG - Intergenic
1062397343 9:136357791-136357813 GGGCTCCTGCGGGTTGGTGGCGG + Intronic
1186585083 X:10864917-10864939 GTGCGCATGCATGTTGGCAGAGG + Intergenic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1187954948 X:24508327-24508349 GTGATCCTGAGTGTTGGCGGTGG - Intronic
1190542965 X:51496858-51496880 GTTCACGTGCGCGTTCGCGGCGG + Intergenic
1192216742 X:69164630-69164652 GTGTGCCTGCGCATGCGCGGGGG + Intronic
1198530867 X:137548862-137548884 GTGCGCCTGGGCGCTGGGGATGG + Intergenic
1198871033 X:141177205-141177227 GTGCGCCGGCGCGACGGGGGAGG + Intergenic
1199445103 X:147912040-147912062 GTGCGGCAGCGCGGCGGCGGCGG + Exonic