ID: 1125811855

View in Genome Browser
Species Human (GRCh38)
Location 15:42548731-42548753
Sequence GACCCAGGACCCGCAGTAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125811843_1125811855 27 Left 1125811843 15:42548681-42548703 CCCCGGACTCGCCTCCCACCGCT 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171
1125811846_1125811855 16 Left 1125811846 15:42548692-42548714 CCTCCCACCGCTCAGCTGCCGTA 0: 1
1: 0
2: 2
3: 6
4: 98
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171
1125811850_1125811855 9 Left 1125811850 15:42548699-42548721 CCGCTCAGCTGCCGTAAGGCTCC 0: 1
1: 0
2: 2
3: 8
4: 87
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171
1125811845_1125811855 25 Left 1125811845 15:42548683-42548705 CCGGACTCGCCTCCCACCGCTCA 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171
1125811847_1125811855 13 Left 1125811847 15:42548695-42548717 CCCACCGCTCAGCTGCCGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171
1125811849_1125811855 12 Left 1125811849 15:42548696-42548718 CCACCGCTCAGCTGCCGTAAGGC 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171
1125811852_1125811855 -2 Left 1125811852 15:42548710-42548732 CCGTAAGGCTCCGCAGGTGAAGA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171
1125811844_1125811855 26 Left 1125811844 15:42548682-42548704 CCCGGACTCGCCTCCCACCGCTC 0: 1
1: 0
2: 1
3: 15
4: 229
Right 1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG 0: 1
1: 0
2: 2
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125811855 Original CRISPR GACCCAGGACCCGCAGTAGC CGG Exonic
900226239 1:1534831-1534853 GCCCCTGGCCCCGCAGTGGCGGG - Intergenic
901089994 1:6634747-6634769 GACGCTGGACCTGCAGGAGCGGG + Exonic
901265589 1:7908182-7908204 GCCCCAGGCTCCGGAGTAGCTGG - Intergenic
902242855 1:15100315-15100337 CACCCAGGACCCTCAGCAGGAGG + Intronic
902417433 1:16249007-16249029 GACCCAGGGCCAGCTGCAGCAGG + Exonic
904684141 1:32248535-32248557 GGCCCAGGTGCCGCAGCAGCGGG - Exonic
908355758 1:63323703-63323725 GACCCTGGACCCGCAGTCCGAGG + Exonic
912493508 1:110076282-110076304 GACCCAGGACCCACACCAGCAGG + Intergenic
912525190 1:110277683-110277705 GACCCAGTACCCCCAGGAGAGGG + Intronic
915145679 1:153794618-153794640 GAGCCAGGACCCCCAGCAGATGG - Intergenic
915436219 1:155908675-155908697 GCCTCAGCCCCCGCAGTAGCTGG + Intronic
915733188 1:158068481-158068503 GACCCCTCATCCGCAGTAGCTGG + Intronic
917189785 1:172402956-172402978 GTCCCAGGACCAGCAGCATCTGG + Intronic
917817599 1:178725835-178725857 GAGCCAGGACCAGCAGAAGCCGG + Intronic
918485082 1:185020387-185020409 GACCCAGCACCCCAAGAAGCTGG + Intergenic
919092826 1:192994680-192994702 GACCCAGGACACCCAGAAGCCGG - Intergenic
922051358 1:221993687-221993709 GAACCAGGCCTCACAGTAGCAGG - Intergenic
1064027540 10:11860499-11860521 GCCTCAGGATCCGGAGTAGCTGG - Intronic
1067180693 10:43983608-43983630 GACCCAGGCCCCGCTGCTGCTGG - Intergenic
1069280867 10:66651783-66651805 CACCCAGAACCCGCATTGGCCGG + Intronic
1069798617 10:71068914-71068936 GACCCAGGGGCCGCAGTGCCAGG + Intergenic
1071467172 10:85951742-85951764 GCCCCAGGGCCCGCAGGTGCTGG + Intronic
1072614518 10:97040423-97040445 GATCCAGTGCCCGGAGTAGCAGG - Intronic
1080273895 11:30481681-30481703 GACCCAGGAACCCAAGTACCAGG + Intronic
1083253864 11:61484780-61484802 GGGCCAGGACCCGCTGGAGCGGG + Exonic
1083784921 11:64939042-64939064 GCCTCAGCACCCCCAGTAGCTGG + Intronic
1085040437 11:73323612-73323634 GGCCCAGGAGCGGCAGGAGCTGG - Intronic
1085514087 11:77102398-77102420 GATGCAAGACCCGCAGGAGCAGG - Intronic
1087580689 11:100048014-100048036 GCCTCAGCACCCCCAGTAGCTGG - Intronic
1087909610 11:103738005-103738027 GGCCCAGGGCCCACAGTTGCTGG + Intergenic
1089527724 11:119107880-119107902 GGCCCGGGACCCGCCTTAGCCGG + Exonic
1089667076 11:120027282-120027304 GCCCCAAGCCCCGCAGGAGCAGG + Intergenic
1089693257 11:120199646-120199668 GAACCTGGAACAGCAGTAGCTGG - Intergenic
1095050884 12:37553628-37553650 GACCCAGAACACCCAGTGGCAGG - Intergenic
1098550476 12:71755575-71755597 GACCCAGGAACTGCAGTAAATGG - Intronic
1099790694 12:87330294-87330316 GGCCCAGCACTCGCAGCAGCCGG + Intergenic
1100481220 12:94981331-94981353 GCCTCAGCACCCGGAGTAGCTGG - Intronic
1101908675 12:108846773-108846795 GACCCAGCACCTGCAGGAGTCGG + Intronic
1104682878 12:130763353-130763375 GGCTCAGCACCCCCAGTAGCTGG - Intergenic
1105855279 13:24366310-24366332 GACCCAGGACCCAGGGCAGCAGG - Intergenic
1110962690 13:81649560-81649582 GCCTCAGCCCCCGCAGTAGCTGG + Intergenic
1111637177 13:90920179-90920201 GCCCCAGGACCCACAGTAGCTGG - Intergenic
1113968068 13:114165903-114165925 GACTGAGGAGCCGCAGTCGCTGG + Intergenic
1114656456 14:24318751-24318773 AACCATGGACCCGTAGTAGCTGG - Exonic
1119335681 14:73831634-73831656 GCCTCAGCCCCCGCAGTAGCTGG + Intergenic
1121053149 14:90832429-90832451 GAGGCAGGACCCTCTGTAGCAGG - Intergenic
1121323800 14:93008056-93008078 GCATAAGGACCCGCAGTAGCTGG - Intronic
1122721587 14:103725395-103725417 GACCCACGCCCCTCAGAAGCAGG + Intronic
1122844151 14:104481580-104481602 GACCCAGGACCCGGGGCAGCAGG - Intronic
1122918941 14:104871703-104871725 GCCCAAGGAGCCGCAGCAGCAGG + Intronic
1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG + Exonic
1126542420 15:49838438-49838460 GAGTCAGGACCCTCAGCAGCAGG + Intergenic
1129112605 15:73346534-73346556 GACCCAGGAAAGCCAGTAGCAGG + Intronic
1129739901 15:77985131-77985153 CCCCCAGGCCCCGCAGGAGCTGG - Intronic
1131728059 15:95249028-95249050 GACCGAGAACCAGAAGTAGCTGG - Intergenic
1132385609 15:101397951-101397973 CACCCAGGCCCCGCTGCAGCAGG - Intronic
1132408461 15:101559612-101559634 GACCCAGGACTAGCATTAGCAGG + Intergenic
1132516405 16:368113-368135 GTCCCAGGACCCTCAGTAGGAGG - Intronic
1132538588 16:496428-496450 GACCCAGGCCCCGCTGTGACAGG - Intronic
1134434201 16:14240413-14240435 GACTCAGGATCTGCAGTTGCAGG - Exonic
1135563341 16:23493466-23493488 GACACAGGACCCCCAGGAGAAGG + Intronic
1137988407 16:53130186-53130208 GTGCCAGCACCTGCAGTAGCCGG - Intronic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138555798 16:57770610-57770632 GAACCAGCACCTGCAGGAGCAGG - Exonic
1139175718 16:64684692-64684714 TACCCAGGCCCCAGAGTAGCAGG - Intergenic
1143034085 17:3984537-3984559 GCCCCAGCCCCCCCAGTAGCTGG + Intergenic
1144367097 17:14555109-14555131 CTCCCAGCACCCTCAGTAGCAGG - Intergenic
1145983499 17:29028528-29028550 GACCCGGGACCCGCTGGGGCTGG - Intronic
1147252990 17:39164912-39164934 GACCGAGGAGCCGCAGTACTAGG + Intronic
1148030923 17:44620299-44620321 GACTCAGCCCCCGAAGTAGCTGG - Intergenic
1148484372 17:47981313-47981335 GACCAAGGAGCTGCAGAAGCTGG + Exonic
1148538349 17:48459392-48459414 GTCCCCAGACCAGCAGTAGCTGG - Intergenic
1148929903 17:51120142-51120164 TTCCCAGGACACTCAGTAGCCGG + Intronic
1148932798 17:51140718-51140740 GCCTCAGCACCCCCAGTAGCTGG - Intergenic
1149865474 17:60149001-60149023 CACAGAGGACCTGCAGTAGCAGG + Intergenic
1149979842 17:61301520-61301542 GACCCAGCCTCCTCAGTAGCTGG - Intronic
1151343445 17:73486670-73486692 GACCCCAGACCCTCAGGAGCTGG - Intronic
1152082619 17:78197771-78197793 GACCCAGGACAAGCAGTGGAGGG + Intronic
1155240767 18:23861758-23861780 GACCCAGGACGCGCTGTGGATGG - Exonic
1156097431 18:33551943-33551965 GACCCAGCCTCCGGAGTAGCTGG - Intergenic
1160907861 19:1460236-1460258 GACCCGGGACCCGCTGAACCTGG + Exonic
1160911139 19:1474324-1474346 GGCCCAGGACCTGCTGCAGCTGG + Exonic
1161017635 19:1991151-1991173 GGCCCAGGACCCCGAGTGGCAGG + Intronic
1163170126 19:15525447-15525469 GCCTCAGGAACCGCAGCAGCAGG - Exonic
1163170381 19:15527126-15527148 GACCATGGACCAGCAGTAGAGGG - Intronic
1163243169 19:16076604-16076626 GATCCAGGCCCTGCAGCAGCAGG + Intronic
1163394764 19:17053348-17053370 GACACAGGTCCCGCAGTTGCAGG - Intronic
1163763441 19:19149433-19149455 GACCCAGGACCCACAGGGGCAGG + Intronic
1163851873 19:19668939-19668961 GACCCAGGACACCCGGAAGCCGG + Exonic
1164145777 19:22511653-22511675 GACCCAGGACTGGCAGGAGCAGG + Intronic
1165573180 19:36792322-36792344 GACCCAGAACACACAGTGGCAGG + Intergenic
1165632493 19:37313338-37313360 GACCCAGAACACACAGTGGCAGG + Intronic
1166778502 19:45326941-45326963 GCCTCAGGCCCCGGAGTAGCTGG - Intergenic
1167793488 19:51694521-51694543 GACCCATGCCCTGCAGGAGCTGG + Intergenic
926423184 2:12718090-12718112 GACCGAGGACCCCCGGGAGCCGG + Exonic
926982260 2:18584717-18584739 GACCCGGGACTCGCAGCCGCTGG - Exonic
927019807 2:19004863-19004885 CACCCAGGACCCGCAGAGCCTGG - Intergenic
928559689 2:32467244-32467266 GTCTCAGGTCCCCCAGTAGCTGG + Intronic
933335533 2:80953828-80953850 GTCCAAGGACCCGCAGGAGATGG - Intergenic
934587699 2:95517993-95518015 GCCTCAGGACCCTCAGCAGCAGG + Intergenic
934631466 2:95928899-95928921 GACCAAGGACCAGCAGCATCAGG + Intronic
934802567 2:97180084-97180106 GACCAAGGACCAGCAGCATCAGG - Intronic
934845163 2:97657591-97657613 GATAGAGGACCAGCAGTAGCTGG - Intronic
935524256 2:104146111-104146133 GCCTCAGCACCCCCAGTAGCTGG + Intergenic
937870251 2:126781343-126781365 GAGCCAGGACAGGCAGGAGCCGG + Intergenic
947946665 2:234109470-234109492 GACCCAGGAGCTGGAGCAGCTGG - Intergenic
948929002 2:241118877-241118899 GCTCCTGGACCCGCAGCAGCTGG + Intronic
1168870364 20:1122409-1122431 GCCCCAGCATCCTCAGTAGCTGG + Intronic
1170586098 20:17735288-17735310 GTCCCTGGACCAGCAGCAGCTGG + Intronic
1176177826 20:63737041-63737063 GACCCTGCACCCGGAGGAGCTGG - Intronic
1180902962 22:19387863-19387885 GACACATGTGCCGCAGTAGCTGG + Intronic
1182017991 22:27056735-27056757 GGCCCAGGACCTGCATTTGCAGG - Intergenic
1182344939 22:29656051-29656073 GCCTCAGCACCCCCAGTAGCTGG + Intronic
1182593348 22:31399254-31399276 GACCCAGGACCCGCAGATGCTGG + Intergenic
1182765051 22:32752718-32752740 GAGCCAGGACCCCCAGAAGGAGG - Intronic
1183375401 22:37461958-37461980 GGCCCAGGACCCGAAACAGCAGG - Intergenic
1183858695 22:40653505-40653527 GACCCAAGACTTGCAGCAGCTGG + Intergenic
952336399 3:32407000-32407022 GCAGCAGCACCCGCAGTAGCTGG + Intronic
952883205 3:37998144-37998166 GACCCAGGACCTGCTGCAGGAGG + Exonic
955091156 3:55752004-55752026 GCTCCAGTACCCTCAGTAGCAGG + Intronic
958769327 3:98407501-98407523 CACACAGGACCCTCAGTTGCAGG - Intergenic
959068564 3:101681724-101681746 GACTCAGGCCCCTAAGTAGCTGG - Intronic
959450819 3:106497573-106497595 GCCCCAGGCTCCACAGTAGCTGG + Intergenic
962982546 3:140503838-140503860 GACCTAGGACCCACAGTATGTGG + Intronic
968190977 3:196666879-196666901 GCCTCAGCCCCCGCAGTAGCTGG - Intronic
969526173 4:7705228-7705250 CACCCAGGGCCCCCAGGAGCTGG + Intronic
969689717 4:8697859-8697881 GACCCAGGAGCAGGAGAAGCAGG - Intergenic
970018416 4:11539036-11539058 GACCCAGGACCCCCAGCTGGAGG + Intergenic
973888999 4:55350875-55350897 GCCTCAGCACCCCCAGTAGCTGG + Intronic
976483540 4:85572989-85573011 GTCTCAGGACCCCAAGTAGCTGG + Intronic
979475882 4:121157099-121157121 GACCCGGGACCGGCTGCAGCGGG - Exonic
979612282 4:122702190-122702212 GCCTCAGCACCCACAGTAGCTGG + Intergenic
984121435 4:175750171-175750193 GCCTCAGTACCCCCAGTAGCTGG + Intronic
984244358 4:177257449-177257471 GCCTCAGCACCCCCAGTAGCTGG + Intergenic
985773574 5:1827957-1827979 GCCCCAGGACACGCAGGATCAGG - Intergenic
985931159 5:3058774-3058796 CACCCAGGACCCGCATTCGAGGG + Intergenic
986012028 5:3725237-3725259 GACCCAGTCTCCGGAGTAGCTGG + Intergenic
986672325 5:10153305-10153327 GCCTCAGCACCCCCAGTAGCTGG - Intergenic
987951326 5:24680353-24680375 GACTCAGTCCCCCCAGTAGCTGG - Intergenic
990343794 5:54851404-54851426 TACCCAGGAACCTCAGTAGAGGG - Intergenic
994204859 5:97023366-97023388 GCCCCAGTATCCGGAGTAGCTGG + Intronic
994702335 5:103150654-103150676 GCCCCAGCCACCGCAGTAGCTGG - Intronic
999328064 5:150655765-150655787 GCCTCAGCCCCCGCAGTAGCTGG + Intronic
1002641259 5:180631672-180631694 GACCCAGTACCTGCAGGAGATGG + Exonic
1002992566 6:2251250-2251272 GTCCCAGCATCCCCAGTAGCTGG - Intergenic
1003365501 6:5471131-5471153 GACCCAGAAGCAGCAGTAGAGGG + Intronic
1003431911 6:6046923-6046945 TAACCAGGACCTGCACTAGCTGG - Intergenic
1004591656 6:17057832-17057854 GCCCCAGCACCCCCAGTAGCTGG + Intergenic
1009593842 6:65709143-65709165 GCCTCAGCACCCCCAGTAGCTGG + Intergenic
1012178445 6:96120383-96120405 GCCTCAGCACCCCCAGTAGCTGG + Intronic
1014474928 6:121860372-121860394 GCCCCAGGGCCCCCAGCAGCAGG - Intergenic
1015634685 6:135263775-135263797 CTCCCTGGTCCCGCAGTAGCCGG - Intergenic
1017658277 6:156650244-156650266 GACTCAGGACACGGAGAAGCTGG - Intergenic
1019714707 7:2533273-2533295 GGCCCAGGACACACAGGAGCAGG + Intergenic
1019741612 7:2677780-2677802 GGCCCAGGACACACAGGAGCAGG - Intergenic
1021100878 7:16585250-16585272 AACCCTGGATCCCCAGTAGCTGG - Intergenic
1021298384 7:18938478-18938500 GACTCAGGCTCCGGAGTAGCTGG - Intronic
1022941822 7:35249178-35249200 GTCCCAGGACCCGAAGTCCCTGG + Intronic
1025296814 7:57782138-57782160 GACCCAGAACACCCAGTGGCAGG - Intergenic
1026706834 7:72701376-72701398 GACTCAGCATCCTCAGTAGCTGG + Intronic
1029694729 7:102205133-102205155 GCTCCAGGACCCGCTGCAGCAGG + Exonic
1032389732 7:131548014-131548036 GTCCCAGGACCCCCATAAGCTGG - Intronic
1033171785 7:139091116-139091138 CACCCAGAACCCTCAGCAGCTGG + Intronic
1036136506 8:6166611-6166633 GACACAGGACCTGCAGTGACTGG + Intergenic
1037677496 8:21064341-21064363 GACCCAACACCCTCAGGAGCCGG - Intergenic
1039647580 8:39304305-39304327 GACTCAGCACCCTGAGTAGCTGG - Intergenic
1039787476 8:40846665-40846687 GACTCAGGAACTGCAGGAGCAGG + Intronic
1042291849 8:67176954-67176976 GACTCAGGCTCCGGAGTAGCTGG - Intronic
1042927420 8:73980201-73980223 GCCTCAGCACCCCCAGTAGCTGG + Intronic
1045285282 8:100785319-100785341 GACCCATGACCCACAGTAAGGGG - Intergenic
1045610721 8:103838059-103838081 GCCTCAGGCCCCCCAGTAGCTGG + Intronic
1047801732 8:128317191-128317213 GCCCCAGGACACCCAGTTGCAGG - Intergenic
1047938657 8:129806529-129806551 GCCTCAGGATCCACAGTAGCAGG + Intergenic
1057146540 9:92763126-92763148 GACCCTGGGCCAGCAGGAGCTGG - Intronic
1061602358 9:131679613-131679635 GACCCCTGACCCACAGAAGCTGG - Intronic
1062257239 9:135632780-135632802 GCCTCAGCACCCCCAGTAGCTGG + Intronic
1062286987 9:135777741-135777763 GACCCAGGAGCCAGAGGAGCTGG - Intronic
1188007875 X:25029410-25029432 GCCCCAGTACCAGCAGCAGCCGG - Intergenic
1191104495 X:56764169-56764191 AACCCAGGACCAGCAGTACCTGG - Intergenic
1195068580 X:101258789-101258811 GCCCCAGGCCCCACAGTGGCTGG - Intronic
1195899081 X:109778663-109778685 GCCTCAGCACCCCCAGTAGCTGG - Intergenic
1197713981 X:129692973-129692995 GCCTCAGCACCCCCAGTAGCTGG - Intergenic
1197843444 X:130775263-130775285 GCCCCAGCACCCCAAGTAGCTGG - Intronic
1200203999 X:154302905-154302927 CACCTAGGGCCAGCAGTAGCTGG + Intronic
1201494193 Y:14575806-14575828 CAATCAGGACCCTCAGTAGCAGG + Intronic