ID: 1125812092

View in Genome Browser
Species Human (GRCh38)
Location 15:42550156-42550178
Sequence TCCAGGACCCATGTGGTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125812092_1125812098 -4 Left 1125812092 15:42550156-42550178 CCGCGGACCACATGGGTCCTGGA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1125812098 15:42550175-42550197 TGGAGGCTCAGATGGGAAGATGG 0: 1
1: 0
2: 68
3: 770
4: 3934
1125812092_1125812100 17 Left 1125812092 15:42550156-42550178 CCGCGGACCACATGGGTCCTGGA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1125812100 15:42550196-42550218 GGCTTGAGCTTAAGAGATGGAGG 0: 1
1: 1
2: 23
3: 320
4: 3482
1125812092_1125812099 14 Left 1125812092 15:42550156-42550178 CCGCGGACCACATGGGTCCTGGA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1125812099 15:42550193-42550215 GATGGCTTGAGCTTAAGAGATGG 0: 1
1: 0
2: 30
3: 334
4: 2362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125812092 Original CRISPR TCCAGGACCCATGTGGTCCG CGG (reversed) Intronic
900359907 1:2283479-2283501 TCCTGCAACCATGTGGGCCGGGG + Intronic
902292858 1:15446645-15446667 TCAAGGATCCAGGTGGCCCGAGG - Exonic
903332272 1:22602271-22602293 TCCAGCACCCATGGGGGCGGGGG + Exonic
905467651 1:38167469-38167491 TCCAGGATGCATTTGGCCCGCGG + Intergenic
906030738 1:42718153-42718175 GCCTGGACCCAAGTGGTCAGAGG - Intergenic
907641851 1:56198532-56198554 TCCAGAGCCCATGTGGTGCTTGG + Intergenic
920087380 1:203427559-203427581 TCCGGGACCTGTGTTGTCCGAGG + Intergenic
924677577 1:246195379-246195401 CACAGGACTCATGTGGTACGGGG + Intronic
1063185676 10:3649004-3649026 TCCTGGACTCATGTGCACCGAGG - Intergenic
1066366425 10:34781293-34781315 ACCAGGACCCATGCAGTCCTTGG + Intronic
1067096305 10:43303063-43303085 TCCAGGACTCACGTCATCCGCGG + Intergenic
1068288934 10:54976688-54976710 TTCAGGAGCCATGTGGCCAGAGG - Intronic
1069591320 10:69644097-69644119 TCTAGGAGCCTTGTGGTCCAGGG + Intergenic
1071177486 10:82943328-82943350 TCAAGGAGCAGTGTGGTCCGTGG - Intronic
1074998474 10:118777848-118777870 TCCAGGGCCCACGTGGTCTCTGG + Intergenic
1077093068 11:788283-788305 CCCAGGACCCTTGGGCTCCGGGG + Exonic
1081543885 11:44056053-44056075 AACAGGACCCATGTGATCTGGGG + Exonic
1083923196 11:65791397-65791419 GGCAGCACCCATGTGGTCAGTGG + Intronic
1083960328 11:66011807-66011829 TCCAGGACACACCTGGCCCGGGG - Intergenic
1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG + Intronic
1090665857 11:128914494-128914516 TCCAGGACAGATGTGGGCCAGGG - Intronic
1091712858 12:2753774-2753796 TCCAGGATCCTTGTGTTCCAGGG - Intergenic
1095351969 12:41223966-41223988 TCCAGGACCCTTCTGGTCAGAGG - Intronic
1101152435 12:101895426-101895448 TCCAGGACTTCTGTGGGCCGAGG - Intronic
1106458156 13:29945482-29945504 TCCTGGCCCCATTTGGTCTGAGG + Intergenic
1108184884 13:47878647-47878669 TTCAGGTCCCATGTGGACAGTGG + Intergenic
1108697260 13:52913421-52913443 TAGAGGACCCATGTGTTCCCTGG + Intergenic
1112422584 13:99266440-99266462 TCCTGGGCCCATGTGGCCCATGG + Intronic
1122839707 14:104451256-104451278 CCCAGGACCCTTGGGCTCCGGGG - Intergenic
1123062856 14:105602046-105602068 CCCAGGCCCCATGGGGTCCCTGG - Intergenic
1125812092 15:42550156-42550178 TCCAGGACCCATGTGGTCCGCGG - Intronic
1127384099 15:58453285-58453307 TCTAGGTCCCATGTGGTGCTGGG - Intronic
1131109622 15:89756919-89756941 TCCAGGTGCCCTGTGGTCCAGGG + Intergenic
1132598170 16:762584-762606 TCCTGGGCCCATGTGGCCCCAGG + Intronic
1138145840 16:54611227-54611249 TCCAGTTCCCATGTGGTCCAGGG + Intergenic
1139596011 16:67958727-67958749 TGAGGGACCCATGTGGTCAGGGG - Intronic
1140516961 16:75550222-75550244 TCCTGGCCCCATCTGGGCCGCGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1144689063 17:17247676-17247698 TCCAAAACCCATGTGGCCCCAGG - Intronic
1146945348 17:36869714-36869736 TCCAGCCACCATGTGGTCCTGGG - Intergenic
1151858632 17:76741556-76741578 TCCTGGACCCAAGTGATCCTTGG - Intronic
1152845495 17:82597183-82597205 TCCTGGCACCATGTGGTCCTCGG + Intronic
1153983408 18:10332016-10332038 GCCAGGACCCTCGTGGTCAGGGG - Intergenic
1154308121 18:13245191-13245213 TGCAGGACCCATGTGTACCTGGG + Intronic
1161506877 19:4648779-4648801 TCCAGGGCCGATGGGGTCCAGGG + Intronic
1167089277 19:47332263-47332285 GCCAGGACCCAGGAGGTCTGGGG - Exonic
1167683895 19:50943496-50943518 TCCAGGAGACATGGGGTCAGGGG + Exonic
1167703487 19:51065055-51065077 TCCCGGAGCCATGTGGCCCCTGG - Exonic
927781535 2:25943276-25943298 TTCAGGAACCATGGGGTCTGAGG - Intronic
936071469 2:109374427-109374449 ACCAGGATCCATGTGGTGTGTGG - Intronic
943713720 2:191126748-191126770 TCCAAGACCCATGTCATCCTGGG - Intronic
947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG + Intergenic
948178328 2:235961197-235961219 TCCCGGCCCCCTGTGCTCCGTGG - Intronic
948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG + Intronic
948912251 2:241010523-241010545 TCCAGGTTCCATGTGGCCTGGGG + Intronic
1174878024 20:54248615-54248637 TCCAGGTCCCATGTGGGCCCTGG - Intergenic
1175135083 20:56817096-56817118 TTCAGGAGCCATGTGGTGTGTGG - Intergenic
1178938109 21:36881803-36881825 CCCAGGACCCATGTGGACAGGGG + Intronic
1179014160 21:37580924-37580946 TGCAGGACCCACGTGGTATGAGG - Intergenic
1180818493 22:18808478-18808500 TCCAGGACCCTTGTCCTCAGTGG - Intergenic
1181204716 22:21242933-21242955 TCCAGGACCCTTGTCCTCAGTGG - Intergenic
1184115043 22:42417397-42417419 TCCAGGTCCCATGGGATCTGGGG + Intronic
1184682671 22:46080401-46080423 GCCAGGAGCCATGTGGTGCTGGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1203222209 22_KI270731v1_random:52482-52504 TCCAGGACCCTTGTCCTCAGTGG + Intergenic
1203268622 22_KI270734v1_random:34332-34354 TCCAGGACCCTTGTCCTCAGTGG - Intergenic
950428817 3:12939198-12939220 TCCAGGAACCATGTGCCCTGGGG - Intronic
950868756 3:16211119-16211141 TCCAGGAGCCCTGTGGTGCCCGG + Exonic
953173647 3:40529821-40529843 TCCAGGAACAGTGTGGTCCTGGG + Intronic
969568384 4:7993353-7993375 TCCAGGCCCCATGTGCTTGGTGG - Intronic
969840970 4:9881567-9881589 TTCAGGCCACATGTGGTCCCTGG + Intronic
975220310 4:71806389-71806411 TCCAGGGCCTGTGTTGTCCGAGG + Intergenic
978209094 4:106113668-106113690 TCCAGGGCCTATGTCGTCCGAGG - Intronic
985748146 5:1659473-1659495 TCCTGCACCCATGTGGCCCGGGG + Intergenic
990475943 5:56162053-56162075 TCTAGGGCCCATTTGGTCTGAGG + Intronic
996874749 5:128228276-128228298 CCCTGGGCCTATGTGGTCCGTGG + Intergenic
997196964 5:131986656-131986678 TCCAGGACTTCTGTGGGCCGAGG - Intronic
999105522 5:149067620-149067642 TTCAGGAGTCATGTGGTCAGAGG - Intergenic
999300055 5:150485688-150485710 TGCAGGACCCACGAGGGCCGGGG - Intergenic
1001786072 5:174414614-174414636 TACAGGACCCATCTGGTCTGTGG - Intergenic
1002599522 5:180346365-180346387 TCCTGGACCCATCTGGTGCTAGG - Intronic
1007500319 6:42292111-42292133 TACAGGACACATGTGCTCCCAGG + Intronic
1018588712 6:165391978-165392000 ACCAGGATCAATGTGGTCAGAGG + Intronic
1019275539 7:173641-173663 TCCAGGGGCCATGGGGCCCGGGG + Intergenic
1023302666 7:38790728-38790750 TCCAGGACCCCTGTGGATCCTGG - Intronic
1024059890 7:45689966-45689988 TCCAGGCCCCCTGTGGGCAGTGG + Intronic
1029142306 7:98419890-98419912 TCCAGGCCCCATGGGGGCCCTGG - Intergenic
1029711706 7:102303509-102303531 TCCAGGGCCCATGTGGCTCATGG - Intronic
1033557708 7:142503168-142503190 TCCAGGACTCATTTGATCCTAGG - Intergenic
1033560162 7:142523226-142523248 TCCAGGACTCATTTGATCCTAGG - Intergenic
1034543820 7:151776945-151776967 TCCAGCACCCAAGGGGTCCTGGG - Intronic
1035403606 7:158584959-158584981 TCCAGAACACATGTGGTTCAAGG - Intronic
1037828981 8:22177197-22177219 TCCAGGACCCCTGGGGGCAGTGG + Intronic
1040535171 8:48302801-48302823 TCCAGGACCAATGTGGAGCTGGG - Intergenic
1043728217 8:83639837-83639859 TCAAGGCACCATGTGATCCGTGG - Intergenic
1045498631 8:102728713-102728735 CCCAGACCCCATGTGGTCCAGGG - Intergenic
1046268441 8:111860855-111860877 TCCAGGGCTCATGAGGACCGTGG + Intergenic
1056813916 9:89786486-89786508 TCCAGGACCCATGCTGCCCTGGG - Intergenic
1186712404 X:12213053-12213075 CCCAGTACCCATCTGGTCCTGGG + Intronic
1188471992 X:30551467-30551489 TCCAGGCCACATGTGGCCCACGG - Intergenic
1193351499 X:80469903-80469925 TCCAGGACTCGTGTCGTTCGAGG - Intergenic
1199708349 X:150450448-150450470 TCCAAGACCCAGGTGATCCTAGG + Intronic
1200000794 X:153058855-153058877 TCCAGGTCCCATGTGGCCTGGGG - Intronic
1200978142 Y:9235477-9235499 TGCAAGACCCACGTGGTCCAGGG + Intergenic