ID: 1125813704

View in Genome Browser
Species Human (GRCh38)
Location 15:42565268-42565290
Sequence CCACTTTGGCTGATGCGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125813700_1125813704 6 Left 1125813700 15:42565239-42565261 CCCAGAGAGTATGGGGGAAAAGT 0: 1
1: 0
2: 3
3: 17
4: 208
Right 1125813704 15:42565268-42565290 CCACTTTGGCTGATGCGTAAAGG 0: 1
1: 0
2: 0
3: 1
4: 64
1125813701_1125813704 5 Left 1125813701 15:42565240-42565262 CCAGAGAGTATGGGGGAAAAGTG 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1125813704 15:42565268-42565290 CCACTTTGGCTGATGCGTAAAGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125813704 Original CRISPR CCACTTTGGCTGATGCGTAA AGG Intronic
903301950 1:22385496-22385518 CCACCTTGGCTGAAGCGTCAGGG - Intergenic
906561490 1:46761240-46761262 CCCCTTTGGCTGAAGGGCAAGGG + Intronic
907975949 1:59431624-59431646 CCACTTTGGATCATGCAGAAAGG - Intronic
912642961 1:111364747-111364769 CGACTTTGGCTAATGGGGAAAGG - Intergenic
1075674015 10:124283354-124283376 ACACCTTGGCTCATGTGTAAGGG + Intergenic
1078889516 11:15541794-15541816 TCACTTTGGCTGATGAGGAGAGG - Intergenic
1079105244 11:17567661-17567683 CCACTTTGCCTGATGGGTTCTGG + Intronic
1085198092 11:74684162-74684184 TCACTTGGGCTGCTGTGTAAAGG + Intergenic
1085350615 11:75795987-75796009 TCACTCTGGCTGTTGCGAAAAGG + Intronic
1087998377 11:104841221-104841243 CCACTCTGGCTGATGGGAATAGG + Intergenic
1101225094 12:102680347-102680369 CAACTTTGTCTTTTGCGTAAAGG + Intergenic
1104714321 12:131006415-131006437 CCACTTAAGCTGATGTGAAATGG - Intronic
1114228216 14:20757751-20757773 CCACTTAGGCAGATGCCTATGGG + Intergenic
1117783377 14:59257771-59257793 CCAATGTGGCTGAAGCCTAATGG - Intronic
1118787734 14:69060138-69060160 CTCCTTTGGCTGATGACTAATGG - Intronic
1120212549 14:81647971-81647993 CCATTTTGTCTGATTCCTAAAGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1122640787 14:103157938-103157960 CCACTCTGGCTGATGGGAACAGG + Intergenic
1125813704 15:42565268-42565290 CCACTTTGGCTGATGCGTAAAGG + Intronic
1138001180 16:53281520-53281542 CCACTCTGGCTGCTGTGTGAAGG - Intronic
1138414470 16:56863487-56863509 ACACTTTGGGTGATGCCTAGGGG + Intergenic
1139086699 16:63595634-63595656 CCATTTTTGCTGTTGGGTAAAGG - Intergenic
1140960194 16:79904381-79904403 CCACTTTGCCTGGTGCATATTGG + Intergenic
1143134818 17:4706239-4706261 CCACTTTGGTTGCTGTGTGAAGG - Intergenic
1143477318 17:7210231-7210253 CAACTTTGGCTGTAGAGTAAGGG + Intronic
1144224232 17:13129194-13129216 GCACTTTGGCTGACACCTAAAGG + Intergenic
1153117147 18:1672785-1672807 CCACTTTGGAAAATGAGTAAAGG + Intergenic
1162859087 19:13492032-13492054 CCACTTTTACTGATGAGGAAAGG + Intronic
1165575607 19:36814295-36814317 CCACTTTGGCTACTGGGAAAAGG + Intergenic
932066574 2:68569515-68569537 CTACTGTGGCTGATGCTAAAAGG + Intronic
935062563 2:99621156-99621178 CCATTTAGGCTGATGAGCAATGG + Intronic
935913839 2:107927240-107927262 CCACTTTGCCTGGTGGGGAAGGG + Intergenic
939819230 2:146935875-146935897 CCAGTTTGGGTGATGTTTAAAGG + Intergenic
940538433 2:154978389-154978411 CCAATCTGGCTGGTGCGTACAGG - Intergenic
942970997 2:181957778-181957800 CAACATTGGCTGATGAGTATGGG - Intronic
945706049 2:213233225-213233247 CCACTGTGGCTGCTGCGTGCAGG + Intergenic
946321500 2:218957319-218957341 CCACTGTTGCTGATGGGAAAAGG + Intergenic
1169681316 20:8217173-8217195 ACACTTTGGCTTCTGCGTGAAGG - Intronic
1169757563 20:9059601-9059623 CCATTTTGGCTGGTTCATAAAGG - Intergenic
1174915432 20:54648624-54648646 CCAGTGTGGCTGGTGCCTAAGGG + Intronic
1175700695 20:61135004-61135026 CCACATGGGCTGATTCCTAAAGG - Intergenic
1177567833 21:22846988-22847010 CCACTTTAGCTGATGCCAAGCGG + Intergenic
1177687766 21:24462159-24462181 CTAATTTGACTGATGTGTAATGG - Intergenic
1182139789 22:27943784-27943806 CCATTTTGCTTGATGGGTAATGG + Intergenic
963698739 3:148597323-148597345 CCAATTTTGCTGAAGCATAATGG - Intergenic
970646420 4:18126263-18126285 CCACTTTGGCAGATCCATTAAGG - Intergenic
977655732 4:99518730-99518752 CCACTGTGGCATATGCATAATGG - Intronic
994514857 5:100758552-100758574 CCACTGCGCCTGATGCATAATGG + Intergenic
1007758644 6:44118062-44118084 ACATTTTGGCTGATGCTTCATGG - Intronic
1008331532 6:50250976-50250998 CCATTTTAGCTGATGCGAACAGG - Intergenic
1016211349 6:141538878-141538900 CCACTTTGGTTGATGAACAAGGG + Intergenic
1022418093 7:30195479-30195501 CCAAGTTGACTGATGCGGAAAGG + Intergenic
1024513824 7:50225993-50226015 TCACTTTGGCTCATGCATCAAGG + Intergenic
1030801022 7:113852089-113852111 CCACTTTAGCTGATGTGGCAGGG + Intergenic
1042682418 8:71400589-71400611 CCATTCTGACTGATGCGAAATGG - Intergenic
1046379139 8:113431268-113431290 CTCCTTTGGATGATGAGTAAAGG + Intronic
1047619884 8:126595493-126595515 CCACTTTGGCTCATTCCTATTGG + Intergenic
1048619964 8:136121132-136121154 CCACTTTGGCTGTTGGGTCCTGG + Intergenic
1051711087 9:19932007-19932029 CCATGATGGCTGATGCATAATGG - Intergenic
1057298157 9:93861216-93861238 CCCCTTTGGCTGCTGCGTGGAGG + Intergenic
1059285357 9:113167624-113167646 CCACTCTGGCTGATACATGAGGG + Intronic
1185720791 X:2379800-2379822 CCACTTGGGCTCAGTCGTAATGG + Intronic
1186734659 X:12448906-12448928 CCCCTCTGGTTGATGCTTAAGGG + Intronic
1187080808 X:15985113-15985135 AGACTTTGGGTGATGTGTAAAGG - Intergenic
1192441100 X:71174400-71174422 CCACTTTGACAGATGGGAAAAGG + Intergenic
1198049976 X:132942268-132942290 CCACTTAAGCTGATGCCTCATGG - Intronic