ID: 1125826904

View in Genome Browser
Species Human (GRCh38)
Location 15:42684400-42684422
Sequence GCCCTGGCTCACCATCTGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125826904_1125826908 19 Left 1125826904 15:42684400-42684422 CCCATCAGATGGTGAGCCAGGGC 0: 1
1: 0
2: 1
3: 8
4: 104
Right 1125826908 15:42684442-42684464 CAGCTAACAAACTAAAGCCAAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1125826904_1125826906 -8 Left 1125826904 15:42684400-42684422 CCCATCAGATGGTGAGCCAGGGC 0: 1
1: 0
2: 1
3: 8
4: 104
Right 1125826906 15:42684415-42684437 GCCAGGGCTTAGCATCTCTGAGG 0: 1
1: 0
2: 0
3: 25
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125826904 Original CRISPR GCCCTGGCTCACCATCTGAT GGG (reversed) Exonic
901618962 1:10566022-10566044 GCTCTGCCTCAGCATCTTATAGG + Intronic
902711450 1:18242864-18242886 TCCCTGGCTCACACTCTGCTGGG + Intronic
902856837 1:19213120-19213142 TCTCTGGCTCTCAATCTGATAGG - Intergenic
904813472 1:33179253-33179275 GCCCTTGCTCACCCTCTGATGGG + Intronic
906686765 1:47767944-47767966 GCCCTGGCTCAGCTTCAGCTAGG + Intronic
908820566 1:68081754-68081776 GTCCTGGCTATGCATCTGATTGG - Intergenic
912324631 1:108746429-108746451 GCCTTGGCTCACGATCGGTTTGG + Intergenic
912386391 1:109273158-109273180 GCCCTGGGCCCCCATCTGGTGGG - Exonic
914704962 1:150162837-150162859 CCCCTGGCTAACAACCTGATGGG - Intronic
915257607 1:154646703-154646725 TCCCTGTCTCACCATGTGACAGG - Intergenic
916130323 1:161606568-161606590 GCCCTCGCTCACCACCTGGAAGG - Intronic
1063815527 10:9767335-9767357 CCCCTGGCTTACCTTCTGCTAGG - Intergenic
1066546403 10:36505063-36505085 TTCCTGGCGCACCATCTAATGGG + Intergenic
1069961149 10:72080309-72080331 GGCCTGGCTCAGCCTCTGAGAGG + Intronic
1073618526 10:105023068-105023090 TCTCAGGCTCACCTTCTGATAGG + Intronic
1081779898 11:45702949-45702971 GGCCTGGCCCAGAATCTGATTGG - Intergenic
1082102088 11:48181027-48181049 GTCCTGGCTGACCATCTGCTAGG + Intergenic
1083325980 11:61873234-61873256 GCCCTGGGTCCTCATCTGCTGGG + Intergenic
1089667492 11:120029635-120029657 GGCCTGGCTCACCCTTTGATTGG - Intergenic
1092021340 12:5205006-5205028 GCCCTGCCTCACCACCGGAAAGG - Intergenic
1095354514 12:41255793-41255815 TCCCTCTCTCACCATGTGATGGG - Intronic
1099866913 12:88294175-88294197 TCCTTAGCTCACCTTCTGATGGG + Intergenic
1100341406 12:93683185-93683207 GCCCAGCCTCCCCATCTGGTGGG + Intronic
1100895085 12:99172527-99172549 GCCCTGGTTCAACAGCTGACTGG + Intronic
1101183815 12:102251194-102251216 GCCCGGCCTCCCCATCTGGTAGG - Intergenic
1102865498 12:116370898-116370920 GCCCTGACCCACCAGCTGTTAGG + Intergenic
1103263087 12:119605726-119605748 GCCCTGCCTTACCCTTTGATAGG + Intronic
1109758045 13:66787770-66787792 GCACTGGGTCGCCAACTGATTGG - Intronic
1111829242 13:93305346-93305368 CCCCTTGCTCAGCACCTGATGGG + Intronic
1113657377 13:112075891-112075913 GACAGGGCTCACCATCTGGTGGG + Intergenic
1117701513 14:58418382-58418404 GTCCTTGCTCACAATCTTATGGG - Intronic
1119599502 14:75965759-75965781 GCCCTGGCTCACCCTTGCATGGG - Intronic
1120836372 14:89041403-89041425 GCCCGGCCTCACCGGCTGATAGG - Intergenic
1121749581 14:96338949-96338971 TCCCTTGCTCACTTTCTGATGGG - Intronic
1125681802 15:41535500-41535522 ACCCCGGCTCACCCTCTGGTGGG + Exonic
1125826904 15:42684400-42684422 GCCCTGGCTCACCATCTGATGGG - Exonic
1128736113 15:70054946-70054968 GGCCTGGCTCAGCATCGTATTGG - Intronic
1132598715 16:764584-764606 ACCCTGGCCCACCATGTGAGTGG + Intronic
1133435784 16:5778404-5778426 CACCTGGTTCACAATCTGATGGG + Intergenic
1134069503 16:11252057-11252079 GCCCTGGCTCACCCGCTCAGTGG + Intronic
1135959660 16:26985084-26985106 GCCCTGGTCCACCATCTTCTTGG + Intergenic
1136450831 16:30353537-30353559 GCCCCGGGCCACCATCTGGTCGG + Exonic
1138146527 16:54617260-54617282 TCCCTGGCTGACAATCTGCTCGG + Intergenic
1141064139 16:80900407-80900429 GCTCTGGGCCTCCATCTGATAGG + Intergenic
1146946591 17:36877720-36877742 GCCCTTGCTGAGCATCTGACGGG + Intergenic
1150218254 17:63481970-63481992 GCCCTGGCTCACCACCACTTGGG - Intergenic
1152154304 17:78622783-78622805 GCCCAGGCTGACCATCTAATCGG - Intergenic
1158119979 18:54038271-54038293 GCCCTTGGTCACCATCATATGGG + Intergenic
1158632271 18:59125920-59125942 GCCTTAGCTCACCATCAGTTAGG + Intergenic
1158700788 18:59744046-59744068 GTCCTGTCTGACCATTTGATTGG - Intergenic
1163237363 19:16037478-16037500 GCCCTGCGACAACATCTGATGGG - Intergenic
1168271993 19:55255044-55255066 GCCCTAGCTCATCATCTTGTTGG - Intronic
926470251 2:13246486-13246508 CCACTGCCTCACCAACTGATTGG - Intergenic
927870106 2:26617957-26617979 ACCTTGGCTCACCCTCTGACTGG + Intronic
928950470 2:36808964-36808986 GCCATGGCTGCCCATCTGAAGGG + Exonic
935097653 2:99961185-99961207 GCCCTGCTTCACCATATGCTGGG - Intronic
940597623 2:155815386-155815408 GCCCTGGCTTCACATGTGATAGG + Intergenic
945072510 2:206005405-206005427 GGACTGGCACACCATCTGACTGG + Exonic
948770407 2:240248770-240248792 GCCCTGCCTCACCCTCTGCAGGG + Intergenic
948978339 2:241478473-241478495 GTCCTGGCACAGCATCTGCTGGG - Intronic
1173542071 20:43861515-43861537 GCACTGGCTCACCATTGGGTTGG + Intergenic
1174354088 20:49987038-49987060 GCCCTGACACACCATCTGCCTGG - Intronic
1175594280 20:60218119-60218141 GCCCTGGCTCTGCTTCTGATGGG + Intergenic
1179221131 21:39408526-39408548 GCCCTGGCTCACCTGGTGTTTGG - Intronic
1182839401 22:33374875-33374897 GCCATGGCTAAAAATCTGATGGG - Intronic
1184715850 22:46281405-46281427 GCCCGGGCACACCAGCTCATGGG - Intronic
953492917 3:43365154-43365176 GCCCTTCCTCAGCGTCTGATTGG - Intronic
956073667 3:65482100-65482122 GCCTTGGCACACCATATCATGGG + Intronic
961000684 3:123371988-123372010 GCCCTGCCCCACCTTCTGCTGGG + Intronic
963921721 3:150911932-150911954 TGCCTGGCTGACCATCTGTTGGG - Intronic
965813315 3:172613724-172613746 ACCCTGGCTCGCCATGTTATGGG - Intergenic
968285090 3:197503897-197503919 GCCCTGCATCACCACCTGACTGG - Intergenic
968607645 4:1543035-1543057 ACCCTGGCTCCCCATCTGAGGGG - Intergenic
968651690 4:1762674-1762696 GCCCTGGCTCCCCTTCTGCCAGG - Intergenic
969651185 4:8469267-8469289 GCCCTGGCTCAGTGGCTGATGGG + Intronic
970374800 4:15446351-15446373 TCCCTCTCTCACCATGTGATAGG - Intergenic
970471265 4:16381566-16381588 GCCCAGGCTCACAAGCTGGTGGG - Intergenic
971166228 4:24186591-24186613 GCCCTTCCTCACCACCTGACAGG - Intergenic
971237619 4:24856859-24856881 GGCCTGGCCCTCCATCTGGTAGG - Intronic
977357896 4:95969592-95969614 GCCCTGGGGCACCATCTGGAGGG - Intergenic
978298999 4:107243612-107243634 GCCCTGGCTCAGGTTCTGAAGGG - Intronic
982719533 4:158845647-158845669 GGCCTGGCTCACTATCTGAATGG - Intronic
985821898 5:2166234-2166256 AGCCTGGCTCCTCATCTGATGGG + Intergenic
986008739 5:3692447-3692469 GTCCTGGCTCTGCAGCTGATGGG + Intergenic
988798973 5:34678699-34678721 GCCCTGGCACACCAGCAGAGGGG + Intronic
996744312 5:126832886-126832908 GCGCTGGTTCATCAACTGATAGG - Intronic
1004851883 6:19707885-19707907 GCCCCGGCTCATCTGCTGATTGG + Intergenic
1005995084 6:30925969-30925991 TCCCTGCCTCCCCTTCTGATGGG - Exonic
1006949251 6:37808026-37808048 GCCCTGGTTCACCACCTGTGTGG + Intergenic
1017873178 6:158503115-158503137 GCCCTGACTCAGCATCAGAGAGG - Exonic
1018460353 6:163992935-163992957 GCCCTGACTCAGAATCAGATGGG + Intergenic
1019496113 7:1341364-1341386 GCCCTGCCTCCCCATCTGTCTGG - Intergenic
1020098778 7:5382776-5382798 GGCCTGTCTCCCCATCTGAATGG + Intronic
1031947650 7:127858235-127858257 TCCCTGGGCCACCATCTGGTCGG + Intronic
1033312976 7:140275810-140275832 GCCATTTCTAACCATCTGATGGG - Intergenic
1034453060 7:151148229-151148251 GCCCTGGAACAGCTTCTGATGGG - Intergenic
1036761836 8:11514759-11514781 GCCCTGGCTGAGCATCAGAATGG + Intronic
1037828023 8:22171111-22171133 GCCTTGGCTCAGCAACTGATGGG - Intronic
1047368768 8:124237530-124237552 ACCTTGGCTCTCCATCTGAGAGG + Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048341638 8:133544307-133544329 GAGCTAGCTCACCATCTTATGGG - Intronic
1049461947 8:142734345-142734367 ACCCTGGCTCCCCATCTCCTCGG - Intronic
1051107557 9:13597124-13597146 GCCCTGGCTCACCATAATATTGG - Intergenic
1052507504 9:29374884-29374906 TCCCTGGCTCAACACCTGAGAGG - Intergenic
1053282811 9:36831992-36832014 GCCCTGCCTCACCAGTTCATAGG + Intergenic
1057441595 9:95087651-95087673 GCCCAGGCTCTCCATTTTATCGG - Intergenic
1057548617 9:96035873-96035895 GCCCTGGCTCAGCTTCTCCTGGG - Intergenic
1059419253 9:114180895-114180917 GCTCTGGCCCACCATCTGTGGGG + Intronic
1062009388 9:134259021-134259043 GCCCTGGCACTGCTTCTGATGGG + Intergenic
1186551868 X:10514833-10514855 GCTCTGGCTCTCCATGTAATAGG - Intronic
1186918346 X:14248079-14248101 GCCCACGCTTACCATCTGAAAGG - Intergenic
1192935696 X:75856778-75856800 CCCCTTGCACACCATCTAATTGG - Intergenic
1195813272 X:108857955-108857977 GCCATGGCTCAACACCAGATTGG - Intergenic
1199294069 X:146137829-146137851 GCCCTGGTTCACCATGGTATTGG - Intergenic