ID: 1125827185

View in Genome Browser
Species Human (GRCh38)
Location 15:42686421-42686443
Sequence CATGCTTCTGTCATGGAATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125827185_1125827187 0 Left 1125827185 15:42686421-42686443 CCAGATTCCATGACAGAAGCATG 0: 1
1: 0
2: 0
3: 26
4: 191
Right 1125827187 15:42686444-42686466 TGAAGTCAAGCAGAACAACTTGG 0: 1
1: 0
2: 2
3: 17
4: 171
1125827185_1125827188 23 Left 1125827185 15:42686421-42686443 CCAGATTCCATGACAGAAGCATG 0: 1
1: 0
2: 0
3: 26
4: 191
Right 1125827188 15:42686467-42686489 AAGAATGCCTTCAGAGTTGCAGG 0: 1
1: 0
2: 2
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125827185 Original CRISPR CATGCTTCTGTCATGGAATC TGG (reversed) Exonic