ID: 1125827186 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:42686428-42686450 |
Sequence | GACTTCACATGCTTCTGTCA TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 154 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 14, 4: 137} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1125827186_1125827187 | -7 | Left | 1125827186 | 15:42686428-42686450 | CCATGACAGAAGCATGTGAAGTC | 0: 1 1: 0 2: 2 3: 14 4: 137 |
||
Right | 1125827187 | 15:42686444-42686466 | TGAAGTCAAGCAGAACAACTTGG | 0: 1 1: 0 2: 2 3: 17 4: 171 |
||||
1125827186_1125827188 | 16 | Left | 1125827186 | 15:42686428-42686450 | CCATGACAGAAGCATGTGAAGTC | 0: 1 1: 0 2: 2 3: 14 4: 137 |
||
Right | 1125827188 | 15:42686467-42686489 | AAGAATGCCTTCAGAGTTGCAGG | 0: 1 1: 0 2: 2 3: 13 4: 192 |
||||
1125827186_1125827190 | 24 | Left | 1125827186 | 15:42686428-42686450 | CCATGACAGAAGCATGTGAAGTC | 0: 1 1: 0 2: 2 3: 14 4: 137 |
||
Right | 1125827190 | 15:42686475-42686497 | CTTCAGAGTTGCAGGAAACCTGG | 0: 1 1: 0 2: 1 3: 30 4: 200 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1125827186 | Original CRISPR | GACTTCACATGCTTCTGTCA TGG (reversed) | Exonic | ||