ID: 1125827187 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:42686444-42686466 |
Sequence | TGAAGTCAAGCAGAACAACT TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 191 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 17, 4: 171} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1125827185_1125827187 | 0 | Left | 1125827185 | 15:42686421-42686443 | CCAGATTCCATGACAGAAGCATG | 0: 1 1: 0 2: 0 3: 26 4: 191 |
||
Right | 1125827187 | 15:42686444-42686466 | TGAAGTCAAGCAGAACAACTTGG | 0: 1 1: 0 2: 2 3: 17 4: 171 |
||||
1125827186_1125827187 | -7 | Left | 1125827186 | 15:42686428-42686450 | CCATGACAGAAGCATGTGAAGTC | 0: 1 1: 0 2: 2 3: 14 4: 137 |
||
Right | 1125827187 | 15:42686444-42686466 | TGAAGTCAAGCAGAACAACTTGG | 0: 1 1: 0 2: 2 3: 17 4: 171 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1125827187 | Original CRISPR | TGAAGTCAAGCAGAACAACT TGG | Exonic | ||