ID: 1125827188

View in Genome Browser
Species Human (GRCh38)
Location 15:42686467-42686489
Sequence AAGAATGCCTTCAGAGTTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125827186_1125827188 16 Left 1125827186 15:42686428-42686450 CCATGACAGAAGCATGTGAAGTC 0: 1
1: 0
2: 2
3: 14
4: 137
Right 1125827188 15:42686467-42686489 AAGAATGCCTTCAGAGTTGCAGG 0: 1
1: 0
2: 2
3: 13
4: 192
1125827185_1125827188 23 Left 1125827185 15:42686421-42686443 CCAGATTCCATGACAGAAGCATG 0: 1
1: 0
2: 0
3: 26
4: 191
Right 1125827188 15:42686467-42686489 AAGAATGCCTTCAGAGTTGCAGG 0: 1
1: 0
2: 2
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125827188 Original CRISPR AAGAATGCCTTCAGAGTTGC AGG Exonic