ID: 1125827190

View in Genome Browser
Species Human (GRCh38)
Location 15:42686475-42686497
Sequence CTTCAGAGTTGCAGGAAACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125827186_1125827190 24 Left 1125827186 15:42686428-42686450 CCATGACAGAAGCATGTGAAGTC 0: 1
1: 0
2: 2
3: 14
4: 137
Right 1125827190 15:42686475-42686497 CTTCAGAGTTGCAGGAAACCTGG 0: 1
1: 0
2: 1
3: 30
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125827190 Original CRISPR CTTCAGAGTTGCAGGAAACC TGG Exonic