ID: 1125828377

View in Genome Browser
Species Human (GRCh38)
Location 15:42694193-42694215
Sequence TGAGTTCCACGCTGAGTGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125828377_1125828378 -1 Left 1125828377 15:42694193-42694215 CCTCTCACTCAGCGTGGAACTCA 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1125828378 15:42694215-42694237 ACAGAAGCGAAACTGCACCATGG 0: 1
1: 0
2: 0
3: 8
4: 134
1125828377_1125828382 10 Left 1125828377 15:42694193-42694215 CCTCTCACTCAGCGTGGAACTCA 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1125828382 15:42694226-42694248 ACTGCACCATGGCTTTGGGGAGG 0: 1
1: 0
2: 1
3: 12
4: 152
1125828377_1125828380 6 Left 1125828377 15:42694193-42694215 CCTCTCACTCAGCGTGGAACTCA 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1125828380 15:42694222-42694244 CGAAACTGCACCATGGCTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1125828377_1125828384 28 Left 1125828377 15:42694193-42694215 CCTCTCACTCAGCGTGGAACTCA 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1125828384 15:42694244-42694266 GGAGGCCGATGCCCTGCTCCAGG 0: 1
1: 0
2: 0
3: 35
4: 225
1125828377_1125828381 7 Left 1125828377 15:42694193-42694215 CCTCTCACTCAGCGTGGAACTCA 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1125828381 15:42694223-42694245 GAAACTGCACCATGGCTTTGGGG 0: 1
1: 0
2: 0
3: 9
4: 134
1125828377_1125828379 5 Left 1125828377 15:42694193-42694215 CCTCTCACTCAGCGTGGAACTCA 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1125828379 15:42694221-42694243 GCGAAACTGCACCATGGCTTTGG 0: 1
1: 0
2: 1
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125828377 Original CRISPR TGAGTTCCACGCTGAGTGAG AGG (reversed) Exonic
900429579 1:2595429-2595451 TGAGTGCCACACTGTGGGAGGGG + Intronic
902792356 1:18777977-18777999 TGAGTTCTTCACTGAGAGAGTGG + Intergenic
904615374 1:31746653-31746675 TGAGGTCATCGCTGAGAGAGTGG - Intronic
906319887 1:44809238-44809260 TCAATACCAAGCTGAGTGAGTGG - Intronic
907570552 1:55479177-55479199 TGACTCCCAGGCTGAGTGAAGGG - Intergenic
909795853 1:79735046-79735068 TGAGTTTCACTCTGAGGTAGGGG - Intergenic
915460846 1:156069908-156069930 TGAGCTCCAGACTGAGTGGGAGG - Intronic
918688760 1:187453153-187453175 TGAATTCCAAGCTGATTGACAGG + Intergenic
1063893890 10:10658956-10658978 TGAGTTCAACTCTGGGTAAGTGG - Intergenic
1067269790 10:44780513-44780535 TGTCTTCAAAGCTGAGTGAGAGG + Intergenic
1067539938 10:47143963-47143985 TGAGCTCCACCCTGAGCGGGTGG - Intergenic
1069580708 10:69564349-69564371 TGAGATCCCTCCTGAGTGAGTGG - Intergenic
1069595832 10:69669537-69669559 TGAGTGACATGGTGAGTGAGGGG - Intergenic
1070127548 10:73634402-73634424 TGATGTCTACGCTGAGTGTGGGG - Intronic
1071276841 10:84063378-84063400 TGAGTTCCACCCAGAGGGAGAGG - Intergenic
1071886622 10:89958234-89958256 TGTGTTCCAGACTGACTGAGAGG - Intergenic
1076843891 10:133059765-133059787 TGAGACCCAGGCTGAGTGGGGGG - Intergenic
1077167103 11:1148651-1148673 TGAGTCCCAGGCTGTGTGTGGGG + Intergenic
1077535252 11:3120859-3120881 TGAGTTCCACTCTGAGTCCTGGG - Intronic
1081901289 11:46630419-46630441 TGTGTTTCATGATGAGTGAGTGG + Intronic
1084861027 11:72018333-72018355 TGGGTTCCTGGCTGGGTGAGGGG + Intronic
1085076537 11:73597466-73597488 TGATTTCAACGGAGAGTGAGTGG - Intronic
1087891295 11:103541184-103541206 TGAGGTCCACGGGGAGTGGGTGG + Intergenic
1088474287 11:110219207-110219229 TGTCTTCCAAGCTGAGTAAGAGG + Intronic
1092319746 12:7459916-7459938 TGAGTTCCACTGTGAGAGGGTGG - Intronic
1096473838 12:51896097-51896119 TGGGTTCCATGCTGAGCCAGAGG - Intergenic
1097128409 12:56791379-56791401 TGCACTCCAGGCTGAGTGAGAGG + Intergenic
1098610986 12:72458015-72458037 TGAGTTCCATGCTGTGGGATGGG + Intronic
1098742574 12:74192919-74192941 AGAGTTCCACACTGCGTGGGGGG + Intergenic
1101400759 12:104384700-104384722 TTACTTCCAGGCTGAGTCAGTGG + Intergenic
1102716365 12:114976553-114976575 TGAATTCCATGATGAGTAAGTGG - Intergenic
1103981674 12:124740899-124740921 TGAGTTCCATGGGCAGTGAGTGG + Intergenic
1121815458 14:96925098-96925120 TGAGATCCCAGCTGAGAGAGAGG - Intronic
1122638437 14:103141920-103141942 TGAGGTCCCGGCTGAGGGAGGGG - Intergenic
1125767203 15:42143821-42143843 TGGGTTCCACTCTGTGTGTGAGG - Intronic
1125828377 15:42694193-42694215 TGAGTTCCACGCTGAGTGAGAGG - Exonic
1128253733 15:66182053-66182075 GGAGTTCCACTGTGAGGGAGGGG - Intronic
1128555550 15:68629352-68629374 TCAGCTCCAGGCTCAGTGAGTGG - Intronic
1129288343 15:74543709-74543731 TGAGTTTTAAGATGAGTGAGTGG - Intronic
1132036662 15:98490995-98491017 TGAGTTCCCCACTGTGTGACTGG + Intronic
1132819229 16:1854551-1854573 TGAGTTCCACGCTGAGCCATGGG - Intronic
1134135858 16:11675992-11676014 TGAGTTCCAGCCTCACTGAGTGG + Exonic
1136906277 16:34096518-34096540 TGCGTTCCAGGCTGGGTGACTGG - Intergenic
1137428851 16:48402101-48402123 TGAGTTCCAGGCAGAGGAAGGGG + Intronic
1146744467 17:35315096-35315118 TGTGTTCCTCTCTGAGAGAGAGG + Intergenic
1148625149 17:49063468-49063490 TGAGTTGGAGGCTGAGTTAGTGG + Intergenic
1149091798 17:52792052-52792074 GGAGTTCCAAGTGGAGTGAGAGG - Intergenic
1151627852 17:75288802-75288824 GGAGTTCCAGGGTGGGTGAGAGG - Intronic
1153242233 18:3041549-3041571 TGCCCTCCAAGCTGAGTGAGAGG - Intergenic
1161253836 19:3295467-3295489 TGTGTCCCCCGCTGAGTGACCGG - Intronic
1167672338 19:50860425-50860447 TGGGATCCACACTGAGAGAGTGG + Exonic
1168472350 19:56649828-56649850 TGAGTTTTACTCTGAGTGGGTGG + Intronic
1168651731 19:58096483-58096505 AGAGCTCCACGGTGGGTGAGGGG + Intronic
934534107 2:95118655-95118677 GGAGTACCACACTGTGTGAGAGG - Intronic
941617047 2:167732579-167732601 TTGGTTCCATGCTGAGAGAGTGG - Intergenic
945498188 2:210535237-210535259 TTGGTGCCATGCTGAGTGAGGGG + Intronic
946617452 2:221525238-221525260 GGAGTTCCACGCAGCGTGATGGG - Intronic
947133764 2:226956182-226956204 GGAGTCCCACTGTGAGTGAGTGG + Intronic
947293956 2:228610027-228610049 AGATTTTCACGCTGAATGAGAGG + Intergenic
948462854 2:238138737-238138759 CGAGGTCCAGGCTGAGTGAGAGG + Exonic
948623702 2:239253141-239253163 TGAGTTGCACGTTGAGTGATAGG - Intronic
948833184 2:240610494-240610516 TGTATTCCAGGCTGAGTGACAGG - Intronic
1172838328 20:37887125-37887147 TGAGTTCCAGGCTGTGTGCCAGG + Intergenic
1172873110 20:38147949-38147971 TGAGTGGCATGGTGAGTGAGTGG - Exonic
1175264590 20:57695083-57695105 TGAGGTCCACGCTGTCTGGGAGG + Intronic
1175304577 20:57967040-57967062 TGAGTTCCCTGGTGAGAGAGGGG + Intergenic
1180099673 21:45578735-45578757 AGAGCTCCAGGCTGAGTGGGAGG - Intergenic
1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG + Intergenic
1181133751 22:20750113-20750135 TGAGTTCCACTCTGAGGTACTGG - Intronic
1182710415 22:32319175-32319197 TGAGTTCCACTATGAGTCAAGGG - Intergenic
1183107772 22:35627319-35627341 TGAGTTTCTCGCTGAGTGACCGG + Intronic
1184397979 22:44256140-44256162 TGAGTTCCACTATGAGTCAAGGG - Intronic
1184837788 22:47034228-47034250 AGAGCTCCACACTGAGGGAGGGG - Intronic
1185226056 22:49653479-49653501 TGAGATCCATGCTGTGTGTGGGG + Intronic
952262383 3:31753086-31753108 TAAGTTCCCCTCTGAGTCAGGGG + Intronic
955896671 3:63707715-63707737 TGAGTTCAACCATGAGTCAGGGG - Intergenic
965747169 3:171937675-171937697 TGAGTTCCATGGAGAGAGAGAGG - Intronic
968698414 4:2043502-2043524 TCAGTTCCAGGCTCTGTGAGTGG - Intronic
969527561 4:7711649-7711671 TGAGTGCCATTCTGAGTGATGGG + Intronic
969964704 4:10982374-10982396 TGAGTAGCACGTTGAGGGAGGGG + Intergenic
976648474 4:87410000-87410022 TGGGTTCTAAGCTGAGTAAGGGG - Intergenic
985018887 4:185666196-185666218 TGATTTCCAAGCTGAGTATGAGG + Intronic
986007906 5:3683653-3683675 TGAGCTTTGCGCTGAGTGAGAGG - Intergenic
991450857 5:66749237-66749259 TGAGGTCCAGTCTGAGAGAGAGG + Intronic
992068687 5:73130020-73130042 TGAGTTCCAGGGTGAGTGACAGG + Intronic
993059338 5:83020058-83020080 TGTGTTTCACACTGAGTGATAGG - Intergenic
993864523 5:93176344-93176366 TGGTTTTCACTCTGAGTGAGAGG - Intergenic
997271502 5:132542813-132542835 AGGATTCCACACTGAGTGAGAGG - Intronic
1001905846 5:175472449-175472471 TGAGCTCCAGTGTGAGTGAGAGG + Intergenic
1006430580 6:33993313-33993335 TGCGTTCCAGGCTGAGTGAGTGG + Intergenic
1010345632 6:74806917-74806939 TGAGTTTCAGGTTGAGAGAGAGG - Intergenic
1010765228 6:79771172-79771194 TGAGTTCCAAATTGAGGGAGAGG + Intergenic
1015478705 6:133682701-133682723 GAAATTCCACACTGAGTGAGTGG + Intergenic
1016988202 6:149910492-149910514 AGAGTTCCATGCAGAGGGAGAGG + Intergenic
1019413175 7:915454-915476 TGAAGCCCACGCTGAGTGAATGG - Intronic
1024637331 7:51301408-51301430 TGAGTTCCGCGCTGAGGTACAGG - Intronic
1024670015 7:51585736-51585758 TGGGTTCAAGGCTGGGTGAGAGG + Intergenic
1026796002 7:73366517-73366539 TGAGGTCCACACTGTGTGTGTGG - Intergenic
1027052690 7:75029823-75029845 TGGGTACCATGCTGAGGGAGGGG + Intronic
1027546183 7:79529940-79529962 AGAATTTCACGCTGAGTGAGAGG - Intergenic
1030199314 7:106886367-106886389 TGGCCTCCAAGCTGAGTGAGAGG - Intronic
1038113373 8:24524958-24524980 TGAGTTTCACGCCAAGGGAGGGG + Intronic
1042529478 8:69800287-69800309 TGCATTCCAGGCTGAGTGACAGG - Intronic
1043684022 8:83065860-83065882 GGAGTTCCCCTCTGAGTGTGAGG - Intergenic
1047881044 8:129193692-129193714 TAGGTTCCACGCTTAGTAAGTGG - Intergenic
1052121654 9:24725199-24725221 TGACTTCCACCATGATTGAGAGG + Intergenic
1052659125 9:31405480-31405502 TGAATTCTAAGCTGAGTGTGTGG - Intergenic
1057328027 9:94084468-94084490 AAAGTTCCTCACTGAGTGAGTGG + Exonic
1057700674 9:97361230-97361252 TGAATGCCAGGCTGAGTGAGTGG - Intronic
1057878349 9:98774490-98774512 TGCATTCCAGACTGAGTGAGGGG + Intronic
1061026592 9:128053751-128053773 TGAGATCCACGCTGGATGTGAGG + Intergenic
1186350715 X:8736151-8736173 TGAGTTCCAGCCTCAGTGACAGG + Intergenic
1190051700 X:47155174-47155196 TGGGTTCCAAGCTGAGTTCGTGG + Intronic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1198370419 X:135984219-135984241 TGAGTTCCAGGCAGAATGATAGG + Intergenic
1199322986 X:146463016-146463038 TGACTTCCACGATGATTGAGTGG + Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic
1202143596 Y:21754997-21755019 TGTATTCCAGCCTGAGTGAGAGG - Intergenic